Incidental Mutation 'R4586:Ercc5'
ID344063
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 5
SynonymsXpg
MMRRC Submission 041807-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4586 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location44147744-44181260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44158857 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 145 (V145I)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
Predicted Effect probably benign
Transcript: ENSMUST00000027214
AA Change: V145I

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: V145I

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155862
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A T 16: 90,927,426 V136D probably damaging Het
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Aqr T C 2: 114,112,577 T1172A probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Atrn T C 2: 130,982,042 F967S probably damaging Het
Btnl1 A G 17: 34,382,462 D323G probably damaging Het
Cadps C A 14: 12,505,808 C754F probably damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Cic A T 7: 25,272,778 I645L probably benign Het
Clca1 C A 3: 145,016,858 C251F probably damaging Het
Cldn16 A T 16: 26,477,558 T95S probably benign Het
Cntnap4 C T 8: 112,810,710 H738Y probably benign Het
Col8a2 A T 4: 126,311,019 probably benign Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cyp4a12a T C 4: 115,327,312 F295L probably benign Het
Cyp4a12b T G 4: 115,432,506 M190R probably damaging Het
Dagla A G 19: 10,271,009 Y96H probably damaging Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Ddx27 T A 2: 167,019,984 D135E probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Dnhd1 T C 7: 105,678,049 L735P probably damaging Het
Dnmt1 G A 9: 20,926,693 P242S probably benign Het
Dync1h1 G A 12: 110,649,483 D3022N probably benign Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 T C 18: 6,449,138 N453S possibly damaging Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Fig4 A C 10: 41,188,632 S872A probably damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm16432 A G 1: 178,122,785 D734G possibly damaging Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gprc5a T A 6: 135,083,452 M313K probably benign Het
H2-T3 T C 17: 36,189,344 probably null Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Hook3 T G 8: 26,032,011 K679T probably damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Jmjd7 T A 2: 120,032,168 M306K probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Kmo T A 1: 175,650,572 M208K probably damaging Het
Kmo G T 1: 175,650,573 M208I possibly damaging Het
Masp2 A G 4: 148,613,901 T480A probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mrpl43 A G 19: 45,005,889 I97T possibly damaging Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Ncam2 T A 16: 81,465,569 H303Q probably benign Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Pno1 T C 11: 17,211,438 K24E probably benign Het
Qdpr T A 5: 45,439,327 N165I possibly damaging Het
Robo2 A G 16: 73,961,873 V674A probably damaging Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Samd11 A G 4: 156,249,432 L174P probably damaging Het
Scn2a T A 2: 65,743,051 probably null Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx25 A T 8: 46,116,437 probably benign Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Stt3a T A 9: 36,741,793 Q531L probably damaging Het
Tcl1 A C 12: 105,217,508 probably benign Het
Trip11 A T 12: 101,883,341 M1488K possibly damaging Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Ulk3 C T 9: 57,594,310 L425F possibly damaging Het
Vmn1r238 T A 18: 3,123,294 K40M probably damaging Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdyhv1 A T 15: 58,148,344 I34F probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Zfp846 G T 9: 20,593,513 C223F probably damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense not run
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAAGGAAAAGTCAGCCATTGTC -3'
(R):5'- TCCTAGAAGACAGATCCACTAAATG -3'

Sequencing Primer
(F):5'- GAAAAGTCAGCCATTGTCCTTGAGC -3'
(R):5'- GAGACCTCCCAATCTGACATTATAGG -3'
Posted On2015-09-24