Incidental Mutation 'R0064:Nutf2'
ID34407
Institutional Source Beutler Lab
Gene Symbol Nutf2
Ensembl Gene ENSMUSG00000008450
Gene Namenuclear transport factor 2
SynonymsPP15, Ntf2, 2700067I02Rik
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0064 (G1)
Quality Score175
Status Validated
Chromosome8
Chromosomal Location105860580-105879330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105878809 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 92 (D92G)
Ref Sequence ENSEMBL: ENSMUSP00000148713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008594] [ENSMUST00000040254] [ENSMUST00000119261] [ENSMUST00000136048] [ENSMUST00000212042] [ENSMUST00000212200] [ENSMUST00000212484] [ENSMUST00000212610]
Predicted Effect probably damaging
Transcript: ENSMUST00000008594
AA Change: D92G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008594
Gene: ENSMUSG00000008450
AA Change: D92G

DomainStartEndE-ValueType
Pfam:NTF2 10 121 1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040254
SMART Domains Protein: ENSMUSP00000039134
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
coiled coil region 1001 1030 N/A INTRINSIC
low complexity region 1267 1285 N/A INTRINSIC
PDB:2VXG|B 1286 1402 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000119261
SMART Domains Protein: ENSMUSP00000113854
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
coiled coil region 985 1014 N/A INTRINSIC
low complexity region 1251 1269 N/A INTRINSIC
PDB:2VXG|B 1270 1386 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000136048
SMART Domains Protein: ENSMUSP00000114285
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
Blast:WD40 33 93 9e-8 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
low complexity region 549 584 N/A INTRINSIC
low complexity region 604 632 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
low complexity region 961 990 N/A INTRINSIC
low complexity region 1215 1233 N/A INTRINSIC
PDB:2VXG|B 1234 1317 1e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000212042
AA Change: D92G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000212200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212398
Predicted Effect probably benign
Transcript: ENSMUST00000212484
Predicted Effect probably benign
Transcript: ENSMUST00000212610
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Nutf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:Nutf2 APN 8 105875600 missense probably damaging 1.00
FR4340:Nutf2 UTSW 8 105876570 missense probably damaging 1.00
R0329:Nutf2 UTSW 8 105876363 missense probably damaging 1.00
R0377:Nutf2 UTSW 8 105878872 missense probably damaging 1.00
R1842:Nutf2 UTSW 8 105876610 critical splice donor site probably null
R4488:Nutf2 UTSW 8 105876427 critical splice donor site probably null
R6562:Nutf2 UTSW 8 105875626 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CACCTATGTGACCAGCAGTTTCCC -3'
(R):5'- ACACAAACTTCCTGTCAGATGCGAC -3'

Sequencing Primer
(F):5'- GCAGTTTCCCACATAGTAATTCACG -3'
(R):5'- ATATTTGGAGCATCTGGAGGAG -3'
Posted On2013-05-09