Incidental Mutation 'R4587:Rasip1'
ID344168
Institutional Source Beutler Lab
Gene Symbol Rasip1
Ensembl Gene ENSMUSG00000044562
Gene NameRas interacting protein 1
SynonymsRain, 2610025P08Rik
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4587 (G1)
Quality Score150
Status Validated
Chromosome7
Chromosomal Location45627488-45639093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45632735 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 554 (V554A)
Ref Sequence ENSEMBL: ENSMUSP00000062429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057927]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057927
AA Change: V554A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062429
Gene: ENSMUSG00000044562
AA Change: V554A

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 59 67 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
RA 141 253 6.94e-8 SMART
low complexity region 284 308 N/A INTRINSIC
low complexity region 310 326 N/A INTRINSIC
low complexity region 327 339 N/A INTRINSIC
SCOP:d1gxca_ 391 484 1e-2 SMART
low complexity region 498 509 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
DIL 768 877 4.14e-44 SMART
low complexity region 928 947 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155241
AA Change: T115A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211533
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation exhibit complete embryonic lethality during organogenesis associated with a failure in cardiovascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,152 I971T possibly damaging Het
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Arhgap32 T C 9: 32,260,945 S1674P probably benign Het
Cd244 T G 1: 171,577,879 D277E probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Cluap1 T A 16: 3,933,816 probably null Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Gm5155 C T 7: 17,886,224 L18F possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Kif22 A T 7: 127,032,880 probably null Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Smr2 G A 5: 88,108,772 R103H probably benign Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Trim72 A G 7: 128,007,992 D231G probably benign Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp51 C T 17: 21,464,916 Q598* probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in Rasip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Rasip1 APN 7 45636764 nonsense probably null
IGL01995:Rasip1 APN 7 45636816 missense probably damaging 0.99
R0208:Rasip1 UTSW 7 45632575 missense probably damaging 0.97
R0373:Rasip1 UTSW 7 45635244 missense possibly damaging 0.50
R0869:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R0870:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R0871:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R0872:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R1388:Rasip1 UTSW 7 45630232 missense probably damaging 0.98
R1780:Rasip1 UTSW 7 45635318 missense possibly damaging 0.94
R2348:Rasip1 UTSW 7 45629083 critical splice donor site probably null
R2517:Rasip1 UTSW 7 45634823 missense probably damaging 1.00
R4678:Rasip1 UTSW 7 45627823 missense possibly damaging 0.86
R4679:Rasip1 UTSW 7 45627823 missense possibly damaging 0.86
R4714:Rasip1 UTSW 7 45632396 frame shift probably null
R5572:Rasip1 UTSW 7 45636729 missense probably benign 0.00
R6182:Rasip1 UTSW 7 45628455 small deletion probably benign
R7443:Rasip1 UTSW 7 45638724 missense probably damaging 1.00
X0018:Rasip1 UTSW 7 45638868 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTGTTCATGTACAAGGACC -3'
(R):5'- GCAACCGGAAGACTTGTAGGAC -3'

Sequencing Primer
(F):5'- TTCATGTACAAGGACCCCCGC -3'
(R):5'- GACAAGGGGGTGCTCAC -3'
Posted On2015-09-24