Mutagenetix > Incidental Mutation

Incidental Mutation 'R4587:Kif22'

344172

Institutional Source

Beutler Lab

Gene Symbol

Kif22

Ensembl Gene

ENSMUSG00000030677

Gene Name

kinesin family member 22

Synonyms

Kid, Kif22a

MMRRC Submission

042006-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4587 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126626901-126641639 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 126632052 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032915 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000205806]

AlphaFold

Q3V300

Predicted Effect

probably null
Transcript: ENSMUST00000032915

SMART Domains

Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677

Domain	Start	End	E-Value	Type
KISc	36	371	1.12e-140	SMART
low complexity region	399	428	N/A	INTRINSIC
coiled coil region	460	496	N/A	INTRINSIC
HhH1	597	616	2.16e0	SMART
HhH1	627	646	8.65e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205754

Predicted Effect

probably benign
Transcript: ENSMUST00000205806

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206412

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206655

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206873

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206924

Meta Mutation Damage Score

0.9482

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.8%
20x: 93.8%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to implantation due to defective meiosis II and early embryo mitosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd16a	T	C	17: 35,320,063 (GRCm39)		probably null	Het
Adsl	T	C	15: 80,851,968 (GRCm39)		probably null	Het
Arhgap32	T	C	9: 32,172,241 (GRCm39)	S1674P	probably benign	Het
Cd244a	T	G	1: 171,405,447 (GRCm39)	D277E	probably benign	Het
Ceacam23	C	T	7: 17,620,149 (GRCm39)	L18F	possibly damaging	Het
Ces1a	A	G	8: 93,751,932 (GRCm39)	Y401H	probably damaging	Het
Chd9	G	T	8: 91,763,134 (GRCm39)	V2320F	possibly damaging	Het
Chrd	A	G	16: 20,557,325 (GRCm39)	E670G	possibly damaging	Het
Ckap2	A	G	8: 22,666,992 (GRCm39)	S290P	probably benign	Het
Cluap1	T	A	16: 3,751,680 (GRCm39)		probably null	Het
Col15a1	C	T	4: 47,257,184 (GRCm39)	T325M	probably damaging	Het
Cplane1	T	C	15: 8,230,636 (GRCm39)	I971T	possibly damaging	Het
Dnah5	T	C	15: 28,304,745 (GRCm39)	F1652S	probably damaging	Het
Dok6	T	C	18: 89,319,320 (GRCm39)	Q312R	probably benign	Het
Glis1	C	A	4: 107,484,740 (GRCm39)	H600N	possibly damaging	Het
Hivep1	A	G	13: 42,309,704 (GRCm39)	D648G	probably benign	Het
Lmtk3	A	G	7: 45,443,504 (GRCm39)	D729G	possibly damaging	Het
Mapk8ip3	G	A	17: 25,123,761 (GRCm39)	P587L	probably damaging	Het
Muc4	G	C	16: 32,753,919 (GRCm38)	R1265P	probably benign	Het
Myt1l	A	G	12: 29,960,800 (GRCm39)	K1038E	unknown	Het
Nf1	T	A	11: 79,426,863 (GRCm39)		probably null	Het
Nom1	T	C	5: 29,656,163 (GRCm39)	S843P	possibly damaging	Het
Or1e33	A	G	11: 73,738,045 (GRCm39)	I302T	probably benign	Het
Pex14	A	G	4: 149,048,021 (GRCm39)		probably benign	Het
Ptcd1	T	C	5: 145,091,531 (GRCm39)	T523A	possibly damaging	Het
Rasip1	T	C	7: 45,282,159 (GRCm39)	V554A	possibly damaging	Het
Ric3	A	T	7: 108,653,570 (GRCm39)		probably null	Het
Skint4	G	A	4: 111,944,221 (GRCm39)	C11Y	probably damaging	Het
Smr2	G	A	5: 88,256,631 (GRCm39)	R103H	probably benign	Het
Sobp	T	C	10: 43,034,020 (GRCm39)	Y102C	probably damaging	Het
Taar7f	T	A	10: 23,926,473 (GRCm39)	F356I	probably damaging	Het
Tbcd	T	C	11: 121,496,097 (GRCm39)	V1044A	possibly damaging	Het
Tecpr1	C	G	5: 144,149,408 (GRCm39)	V340L	probably damaging	Het
Tle3	A	G	9: 61,281,295 (GRCm39)	I22V	probably damaging	Het
Trim30a	G	A	7: 104,084,851 (GRCm39)	R120*	probably null	Het
Trim72	A	G	7: 127,607,164 (GRCm39)	D231G	probably benign	Het
Vmn2r59	T	A	7: 41,695,648 (GRCm39)	N255Y	probably benign	Het
Vps13a	T	C	19: 16,617,403 (GRCm39)	T3002A	probably damaging	Het
Wnt7a	A	T	6: 91,343,324 (GRCm39)		probably null	Het
Zfp51	C	T	17: 21,685,178 (GRCm39)	Q598*	probably null	Het
Zfp617	A	T	8: 72,683,003 (GRCm39)	N51I	probably damaging	Het
Zfp977	A	T	7: 42,229,614 (GRCm39)	C304S	probably damaging	Het
Zic1	A	G	9: 91,246,875 (GRCm39)	S66P	probably damaging	Het

Other mutations in Kif22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Kif22	APN	7	126,632,645 (GRCm39)	missense	probably damaging	0.96
IGL01333:Kif22	APN	7	126,633,367 (GRCm39)	missense	probably damaging	1.00
R0207:Kif22	UTSW	7	126,641,572 (GRCm39)	start codon destroyed	probably null	0.73
R0723:Kif22	UTSW	7	126,633,078 (GRCm39)	missense	probably damaging	1.00
R1118:Kif22	UTSW	7	126,631,916 (GRCm39)	missense	probably benign
R1521:Kif22	UTSW	7	126,627,011 (GRCm39)	missense	probably damaging	0.99
R2036:Kif22	UTSW	7	126,630,126 (GRCm39)	missense	possibly damaging	0.94
R2092:Kif22	UTSW	7	126,632,802 (GRCm39)	missense	probably damaging	0.99
R3790:Kif22	UTSW	7	126,628,668 (GRCm39)	missense	probably damaging	1.00
R4667:Kif22	UTSW	7	126,632,500 (GRCm39)	missense	probably damaging	1.00
R5082:Kif22	UTSW	7	126,632,549 (GRCm39)	missense	possibly damaging	0.71
R5853:Kif22	UTSW	7	126,632,539 (GRCm39)	missense	possibly damaging	0.92
R6045:Kif22	UTSW	7	126,630,250 (GRCm39)	missense	probably benign	0.00
R6175:Kif22	UTSW	7	126,630,228 (GRCm39)	missense	possibly damaging	0.53
R6195:Kif22	UTSW	7	126,628,131 (GRCm39)	missense	probably damaging	0.99
R6407:Kif22	UTSW	7	126,632,375 (GRCm39)	missense	probably damaging	1.00
R6416:Kif22	UTSW	7	126,628,104 (GRCm39)	missense	possibly damaging	0.95
R6561:Kif22	UTSW	7	126,630,225 (GRCm39)	missense	probably benign	0.38
R7122:Kif22	UTSW	7	126,632,150 (GRCm39)	missense	probably benign	0.01
R7644:Kif22	UTSW	7	126,632,134 (GRCm39)	missense	probably damaging	1.00
R8143:Kif22	UTSW	7	126,632,397 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGGCTCCCAGTTGATTC -3'
(R):5'- GGAGTCTGACCCATACTCTAATTCTC -3'

Sequencing Primer
(F):5'- AGTTGATTCTTCTTCAGGGCC -3'
(R):5'- CACTCCTCAGGACTCTCTGGG -3'

Posted On

2015-09-24