Incidental Mutation 'R4587:Arhgap32'
ID344178
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4587 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32260945 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1674 (S1674P)
Ref Sequence ENSEMBL: ENSMUSP00000138145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]
Predicted Effect probably benign
Transcript: ENSMUST00000168954
AA Change: S1674P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: S1674P

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174641
AA Change: S2023P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: S2023P

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182802
AA Change: S1674P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: S1674P

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,152 I971T possibly damaging Het
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Cd244 T G 1: 171,577,879 D277E probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Cluap1 T A 16: 3,933,816 probably null Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Gm5155 C T 7: 17,886,224 L18F possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Kif22 A T 7: 127,032,880 probably null Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Rasip1 T C 7: 45,632,735 V554A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Smr2 G A 5: 88,108,772 R103H probably benign Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Trim72 A G 7: 128,007,992 D231G probably benign Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp51 C T 17: 21,464,916 Q598* probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGATCTGGACAGACCTCGAG -3'
(R):5'- GTGGCAAGGACAACTCTGTG -3'

Sequencing Primer
(F):5'- TGGCCCTGAGAAACACTCCAG -3'
(R):5'- GGACAACTCTGTGGGCAG -3'
Posted On2015-09-24