Incidental Mutation 'R4587:2410089E03Rik'
ID344189
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4587 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8201152 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 971 (I971T)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110617
AA Change: I971T

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: I971T

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130748
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Arhgap32 T C 9: 32,260,945 S1674P probably benign Het
Cd244 T G 1: 171,577,879 D277E probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Cluap1 T A 16: 3,933,816 probably null Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Gm5155 C T 7: 17,886,224 L18F possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Kif22 A T 7: 127,032,880 probably null Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Rasip1 T C 7: 45,632,735 V554A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Smr2 G A 5: 88,108,772 R103H probably benign Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Trim72 A G 7: 128,007,992 D231G probably benign Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp51 C T 17: 21,464,916 Q598* probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCACAGCCCATTTAAGGAAGC -3'
(R):5'- ATCCATACCGCGCAAAATTG -3'

Sequencing Primer
(F):5'- CAGCCCATTTAAGGAAGCATATATC -3'
(R):5'- GTTTACAGAACACTTGGTAGGCCAC -3'
Posted On2015-09-24