Incidental Mutation 'R4593:Nub1'
ID344206
Institutional Source Beutler Lab
Gene Symbol Nub1
Ensembl Gene ENSMUSG00000028954
Gene Namenegative regulator of ubiquitin-like proteins 1
SynonymsNY-REN-18, 4931404D21Rik, 6330412F12Rik, BS4
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24685532-24710378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24709121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 624 (Y624C)
Ref Sequence ENSEMBL: ENSMUSP00000143657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068693] [ENSMUST00000068825] [ENSMUST00000197407]
Predicted Effect probably benign
Transcript: ENSMUST00000068693
SMART Domains Protein: ENSMUSP00000064785
Gene: ENSMUSG00000055235

DomainStartEndE-ValueType
WD40 4 43 1.62e-8 SMART
WD40 46 83 3.17e-2 SMART
WD40 86 123 1.9e-5 SMART
WD40 126 179 3e-3 SMART
WD40 182 221 2.78e-7 SMART
WD40 224 261 9.9e-4 SMART
WD40 264 301 1.29e-2 SMART
WD40 304 341 6.28e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068825
AA Change: Y600C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070265
Gene: ENSMUSG00000028954
AA Change: Y600C

DomainStartEndE-ValueType
coiled coil region 37 70 N/A INTRINSIC
PDB:1WJU|A 71 162 2e-45 PDB
low complexity region 167 186 N/A INTRINSIC
UBA 375 412 7.29e-8 SMART
UBA 431 468 1.61e-9 SMART
UBA 490 527 1.95e-8 SMART
low complexity region 539 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127320
SMART Domains Protein: ENSMUSP00000119649
Gene: ENSMUSG00000055235

DomainStartEndE-ValueType
WD40 29 63 1.27e2 SMART
WD40 66 103 6.28e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196443
Predicted Effect probably damaging
Transcript: ENSMUST00000197407
AA Change: Y624C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143657
Gene: ENSMUSG00000028954
AA Change: Y624C

DomainStartEndE-ValueType
coiled coil region 61 94 N/A INTRINSIC
PDB:1WJU|A 95 186 2e-45 PDB
low complexity region 191 210 N/A INTRINSIC
UBA 399 436 3.5e-10 SMART
UBA 455 492 8.1e-12 SMART
UBA 514 551 9.5e-11 SMART
low complexity region 563 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200337
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a negative regulator of NEDD8, a ubiquitin-like protein that conjugates with cullin family members in order to regulate vital biological events. The protein encoded by this gene regulates the NEDD8 conjugation system post-transcriptionally by recruiting NEDD8 and its conjugates to the proteasome for degradation. This protein interacts with the product of the AIPL1 gene, which is associated with Leber congenital amaurosis, an inherited retinopathy, and mutations in that gene can abolish interaction with this protein, which may contribute to the pathogenesis. This protein is also known to accumulate in Lewy bodies in Parkinson's disease and dementia with Lewy bodies, and in glial cytoplasmic inclusions in multiple system atrophy, with this abnormal accumulation being specific to alpha-synucleinopathy lesions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Nub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Nub1 APN 5 24689394 start codon destroyed probably null 0.99
IGL02626:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02629:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02633:Nub1 APN 5 24692933 missense probably benign 0.00
IGL02798:Nub1 APN 5 24692814 missense probably damaging 1.00
IGL03384:Nub1 APN 5 24697427 splice site probably benign
IGL03384:Nub1 APN 5 24697426 splice site probably null
R2484:Nub1 UTSW 5 24708702 missense possibly damaging 0.91
R2679:Nub1 UTSW 5 24692925 missense possibly damaging 0.93
R3825:Nub1 UTSW 5 24707853 missense probably benign 0.21
R4180:Nub1 UTSW 5 24692877 missense probably damaging 0.99
R4921:Nub1 UTSW 5 24701469 missense probably benign 0.38
R5175:Nub1 UTSW 5 24702448 missense probably benign 0.28
R5282:Nub1 UTSW 5 24695535 missense probably benign 0.04
R5346:Nub1 UTSW 5 24697416 missense probably damaging 0.96
R5533:Nub1 UTSW 5 24702381 missense possibly damaging 0.93
R5567:Nub1 UTSW 5 24708816 missense possibly damaging 0.54
R5802:Nub1 UTSW 5 24702441 missense possibly damaging 0.95
R6966:Nub1 UTSW 5 24689472 missense probably damaging 1.00
R6967:Nub1 UTSW 5 24708711 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTACCAAAGGCACTGTCAAG -3'
(R):5'- AGACTGTCCTCTGACTGACAAAG -3'

Sequencing Primer
(F):5'- TACCAAAGGCACTGTCAAGGGTAC -3'
(R):5'- GACAAAGTCTCTTCAATACACTGGG -3'
Posted On2015-09-25