Incidental Mutation 'R4593:Vmn1r59'
ID344210
Institutional Source Beutler Lab
Gene Symbol Vmn1r59
Ensembl Gene ENSMUSG00000074401
Gene Namevomeronasal 1 receptor 59
SynonymsV1rd10
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5453400-5454838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5454687 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 25 (F25I)
Ref Sequence ENSEMBL: ENSMUSP00000073768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074132]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074132
AA Change: F25I

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073768
Gene: ENSMUSG00000074401
AA Change: F25I

DomainStartEndE-ValueType
Pfam:TAS2R 1 289 2e-14 PFAM
Pfam:7tm_1 20 279 1.9e-6 PFAM
Pfam:V1R 31 287 3e-16 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Vmn1r59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Vmn1r59 APN 7 5454300 missense probably benign 0.12
IGL02035:Vmn1r59 APN 7 5454209 missense possibly damaging 0.87
IGL02039:Vmn1r59 APN 7 5454381 missense probably benign 0.23
IGL02812:Vmn1r59 APN 7 5454177 missense probably damaging 1.00
R0033:Vmn1r59 UTSW 7 5454434 missense probably benign 0.08
R0115:Vmn1r59 UTSW 7 5454116 missense probably benign 0.07
R1164:Vmn1r59 UTSW 7 5454411 missense probably benign 0.00
R1629:Vmn1r59 UTSW 7 5454467 missense probably damaging 1.00
R1845:Vmn1r59 UTSW 7 5454554 missense probably benign 0.03
R1969:Vmn1r59 UTSW 7 5454039 missense probably damaging 1.00
R1970:Vmn1r59 UTSW 7 5454039 missense probably damaging 1.00
R1971:Vmn1r59 UTSW 7 5454039 missense probably damaging 1.00
R2011:Vmn1r59 UTSW 7 5454284 missense probably damaging 1.00
R3712:Vmn1r59 UTSW 7 5454638 missense probably damaging 0.99
R4580:Vmn1r59 UTSW 7 5454137 missense probably damaging 0.98
R4697:Vmn1r59 UTSW 7 5454452 missense probably damaging 1.00
R4856:Vmn1r59 UTSW 7 5454533 missense possibly damaging 0.92
R4873:Vmn1r59 UTSW 7 5454109 missense probably benign
R4875:Vmn1r59 UTSW 7 5454109 missense probably benign
R4925:Vmn1r59 UTSW 7 5454116 missense probably benign 0.07
R5319:Vmn1r59 UTSW 7 5454210 missense probably damaging 0.99
R6239:Vmn1r59 UTSW 7 5454540 missense probably damaging 1.00
R6533:Vmn1r59 UTSW 7 5454464 missense probably benign 0.00
R6912:Vmn1r59 UTSW 7 5454600 missense probably benign 0.01
R7023:Vmn1r59 UTSW 7 5454478 missense probably benign 0.37
R7205:Vmn1r59 UTSW 7 5454726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTTTACATTTGAGGTCAGTTG -3'
(R):5'- AGTGTGTCAAAGCAGTGCCAG -3'

Sequencing Primer
(F):5'- CAGTTGGAGGCTTCCTTGGAAC -3'
(R):5'- GCAGTGCCAGCTTTTCAAACG -3'
Posted On2015-09-25