Incidental Mutation 'R4593:Vmn1r88'
ID344211
Institutional Source Beutler Lab
Gene Symbol Vmn1r88
Ensembl Gene ENSMUSG00000095902
Gene Namevomeronasal 1 receptor, 88
Synonyms
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13177719-13178669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13177842 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 42 (K42E)
Ref Sequence ENSEMBL: ENSMUSP00000128946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171783]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122190
Predicted Effect probably damaging
Transcript: ENSMUST00000171783
AA Change: K42E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128946
Gene: ENSMUSG00000095902
AA Change: K42E

DomainStartEndE-ValueType
Pfam:TAS2R 1 306 2e-14 PFAM
Pfam:V1R 35 301 1.4e-30 PFAM
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Vmn1r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01828:Vmn1r88 APN 7 13177735 missense probably damaging 1.00
IGL01879:Vmn1r88 APN 7 13178302 missense probably benign 0.12
IGL02028:Vmn1r88 APN 7 13177792 missense probably benign
IGL02586:Vmn1r88 APN 7 13177808 nonsense probably null
IGL03176:Vmn1r88 APN 7 13177852 missense probably damaging 1.00
PIT4466001:Vmn1r88 UTSW 7 13178476 missense possibly damaging 0.83
R1163:Vmn1r88 UTSW 7 13178133 missense probably benign
R1478:Vmn1r88 UTSW 7 13177951 missense probably damaging 1.00
R2376:Vmn1r88 UTSW 7 13177858 missense probably damaging 0.99
R3624:Vmn1r88 UTSW 7 13177863 missense probably benign 0.08
R4543:Vmn1r88 UTSW 7 13177980 missense possibly damaging 0.52
R4721:Vmn1r88 UTSW 7 13178524 nonsense probably null
R5927:Vmn1r88 UTSW 7 13178513 missense probably benign 0.12
R6411:Vmn1r88 UTSW 7 13178043 missense probably damaging 1.00
R6535:Vmn1r88 UTSW 7 13178185 missense probably benign 0.03
R6598:Vmn1r88 UTSW 7 13178223 missense probably damaging 1.00
R6857:Vmn1r88 UTSW 7 13178331 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCTCCTGAGATGTCAATCAG -3'
(R):5'- GCTTAGAACAGAGGTGGTGC -3'

Sequencing Primer
(F):5'- AGTGACACCATCTTCCAG -3'
(R):5'- TGGTGCAGATGGACAGACCC -3'
Posted On2015-09-25