Incidental Mutation 'R4593:Cyp2s1'
ID344212
Institutional Source Beutler Lab
Gene Symbol Cyp2s1
Ensembl Gene ENSMUSG00000040703
Gene Namecytochrome P450, family 2, subfamily s, polypeptide 1
Synonyms1200011C15Rik
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4593 (G1)
Quality Score161
Status Not validated
Chromosome7
Chromosomal Location25802475-25816913 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) ACAGCAGCAGCAGCAGCAGCAGCAG to ACAGCAGCAGCAGCAGCAGCAG at 25816442 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043314] [ENSMUST00000108395] [ENSMUST00000156714]
Predicted Effect probably benign
Transcript: ENSMUST00000043314
SMART Domains Protein: ENSMUSP00000041175
Gene: ENSMUSG00000040703

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 493 6.4e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108395
SMART Domains Protein: ENSMUSP00000104032
Gene: ENSMUSG00000040703

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 440 4e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152560
Predicted Effect probably benign
Transcript: ENSMUST00000156714
SMART Domains Protein: ENSMUSP00000122264
Gene: ENSMUSG00000040703

DomainStartEndE-ValueType
Pfam:p450 1 91 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181552
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and appear normal in terms of body weight, growth rate, organ weight, and daily activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Cyp2s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Cyp2s1 APN 7 25809258 missense probably damaging 1.00
IGL02415:Cyp2s1 APN 7 25808137 missense probably damaging 1.00
IGL02530:Cyp2s1 APN 7 25816424 unclassified probably benign
IGL02927:Cyp2s1 APN 7 25808152 missense probably benign 0.17
IGL03358:Cyp2s1 APN 7 25808148 missense probably damaging 1.00
R0139:Cyp2s1 UTSW 7 25811689 utr 5 prime probably null
R0523:Cyp2s1 UTSW 7 25806050 missense probably damaging 1.00
R0650:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R0652:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R0723:Cyp2s1 UTSW 7 25809548 missense probably benign 0.01
R1086:Cyp2s1 UTSW 7 25805997 missense probably damaging 1.00
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3733:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3813:Cyp2s1 UTSW 7 25805866 splice site probably null
R3958:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R4965:Cyp2s1 UTSW 7 25809285 missense possibly damaging 0.85
R5278:Cyp2s1 UTSW 7 25805884 missense possibly damaging 0.95
R5642:Cyp2s1 UTSW 7 25816319 splice site probably null
R6258:Cyp2s1 UTSW 7 25816442 unclassified probably benign
R6628:Cyp2s1 UTSW 7 25815041 missense probably benign 0.02
R6762:Cyp2s1 UTSW 7 25808070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGCACTTAGAAGGCTCC -3'
(R):5'- GATACATTCGCGCGATGGTG -3'

Sequencing Primer
(F):5'- ACATCCCCTGGTTAGGA -3'
(R):5'- CGCGATGGTGTGAGACTTC -3'
Posted On2015-09-25