Incidental Mutation 'R4593:Emp3'
ID344213
Institutional Source Beutler Lab
Gene Symbol Emp3
Ensembl Gene ENSMUSG00000040212
Gene Nameepithelial membrane protein 3
SynonymsH-4, Ymp, MI-35, H4, HNMP-1
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R4593 (G1)
Quality Score145
Status Validated
Chromosome7
Chromosomal Location45918023-45921404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45919353 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 27 (L27P)
Ref Sequence ENSEMBL: ENSMUSP00000148129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038876] [ENSMUST00000069772] [ENSMUST00000164119] [ENSMUST00000209350] [ENSMUST00000210039] [ENSMUST00000210297] [ENSMUST00000210602] [ENSMUST00000210939] [ENSMUST00000211367]
Predicted Effect probably damaging
Transcript: ENSMUST00000038876
AA Change: L96P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037289
Gene: ENSMUSG00000040212
AA Change: L96P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 156 7.2e-47 PFAM
Pfam:Claudin_2 13 158 8.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069772
SMART Domains Protein: ENSMUSP00000070405
Gene: ENSMUSG00000002781

DomainStartEndE-ValueType
Pfam:DUF3754 182 349 3.6e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164119
AA Change: L96P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132519
Gene: ENSMUSG00000040212
AA Change: L96P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 156 7.2e-47 PFAM
Pfam:Claudin_2 13 158 8.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209292
Predicted Effect probably benign
Transcript: ENSMUST00000209350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210038
Predicted Effect probably benign
Transcript: ENSMUST00000210039
Predicted Effect probably damaging
Transcript: ENSMUST00000210297
AA Change: L96P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210937
Predicted Effect probably damaging
Transcript: ENSMUST00000210939
AA Change: L27P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211280
Predicted Effect probably benign
Transcript: ENSMUST00000211367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211628
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PMP-22/EMP/MP20 family of proteins. The protein contains four transmembrane domains and two N-linked glycosylation sites. It is thought to be involved in cell proliferation, cell-cell interactions and function as a tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Emp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5207:Emp3 UTSW 7 45919949 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGACTTCTCAAGCACTGGC -3'
(R):5'- ATCTCTGAAGCTTGCCTGG -3'

Sequencing Primer
(F):5'- CTCACCGCAGAGCCTCTAAGG -3'
(R):5'- TTGCCTGGCTGAACCTACAGTG -3'
Posted On2015-09-25