Incidental Mutation 'R4593:Mkrn3'
ID344214
Institutional Source Beutler Lab
Gene Symbol Mkrn3
Ensembl Gene ENSMUSG00000070527
Gene Namemakorin, ring finger protein, 3
SynonymsZfp127, D7H15S9-1
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location62417593-62420139 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 62418804 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 413 (W413*)
Ref Sequence ENSEMBL: ENSMUSP00000091898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094340]
Predicted Effect probably null
Transcript: ENSMUST00000094340
AA Change: W413*
SMART Domains Protein: ENSMUSP00000091898
Gene: ENSMUSG00000070527
AA Change: W413*

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 36 46 N/A INTRINSIC
ZnF_C3H1 92 118 7.31e-8 SMART
low complexity region 156 172 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
ZnF_C3H1 275 300 3.95e-4 SMART
RING 347 400 5.14e-7 SMART
low complexity region 415 422 N/A INTRINSIC
ZnF_C3H1 432 458 1.16e-1 SMART
Pfam:MKRN1_C 467 542 1.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Meta Mutation Damage Score 0.692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING (C3HC4) zinc finger motif and several C3H zinc finger motifs. This gene is intronless and imprinted, with expression only from the paternal allele. Disruption of the imprinting at this locus may contribute to Prader-Willi syndrome. An antisense RNA of unknown function has been found overlapping this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Mkrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0558:Mkrn3 UTSW 7 62418864 missense probably benign 0.29
R1885:Mkrn3 UTSW 7 62418738 missense probably benign 0.09
R1886:Mkrn3 UTSW 7 62418738 missense probably benign 0.09
R2904:Mkrn3 UTSW 7 62418459 missense probably benign 0.38
R3117:Mkrn3 UTSW 7 62419214 small deletion probably benign
R3118:Mkrn3 UTSW 7 62419214 small deletion probably benign
R4654:Mkrn3 UTSW 7 62419704 missense probably damaging 1.00
R4735:Mkrn3 UTSW 7 62419704 missense probably damaging 1.00
R5528:Mkrn3 UTSW 7 62418987 missense possibly damaging 0.95
R5932:Mkrn3 UTSW 7 62418907 missense probably damaging 1.00
R5950:Mkrn3 UTSW 7 62419719 missense probably damaging 1.00
R6120:Mkrn3 UTSW 7 62419534 missense probably benign 0.00
R6618:Mkrn3 UTSW 7 62419033 missense probably benign 0.25
R6951:Mkrn3 UTSW 7 62419133 missense possibly damaging 0.68
R7009:Mkrn3 UTSW 7 62419618 missense probably benign 0.05
R7227:Mkrn3 UTSW 7 62419667 missense probably benign 0.03
R7228:Mkrn3 UTSW 7 62419667 missense probably benign 0.03
R7286:Mkrn3 UTSW 7 62418927 missense probably benign 0.15
X0025:Mkrn3 UTSW 7 62419773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACAGGCTCCAAAACTTG -3'
(R):5'- GTCTATGAGAAAGCTGACCCCAG -3'

Sequencing Primer
(F):5'- AACTTGATGCCAGTATGCGC -3'
(R):5'- CTGACCCCAGCGACCGC -3'
Posted On2015-09-25