Incidental Mutation 'R4593:Glra3'
ID344216
Institutional Source Beutler Lab
Gene Symbol Glra3
Ensembl Gene ENSMUSG00000038257
Gene Nameglycine receptor, alpha 3 subunit
Synonyms
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location55940460-56130070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55940881 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 9 (G9V)
Ref Sequence ENSEMBL: ENSMUSP00000000275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000275]
Predicted Effect probably damaging
Transcript: ENSMUST00000000275
AA Change: G9V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000275
Gene: ENSMUSG00000038257
AA Change: G9V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 269 3.7e-55 PFAM
Pfam:Neur_chan_memb 276 434 1.4e-35 PFAM
PDB:2M6I|E 437 474 1e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164020
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ligand-gated ion channel protein family. The encoded protein is a member of the glycine receptor subfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are fertile and display decreased inflammatory pain sensitization without any gross abnormalities in the brain or spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Glra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Glra3 APN 8 55940977 splice site probably benign
IGL01301:Glra3 APN 8 55940962 missense probably benign 0.00
IGL01772:Glra3 APN 8 56089055 missense probably benign 0.22
IGL02280:Glra3 APN 8 55940971 missense possibly damaging 0.67
IGL02386:Glra3 APN 8 56089028 missense probably benign 0.12
IGL02508:Glra3 APN 8 56085144 missense probably benign 0.10
IGL03094:Glra3 APN 8 56125172 missense probably benign
ANU18:Glra3 UTSW 8 55940962 missense probably benign 0.00
R0532:Glra3 UTSW 8 56125076 missense probably benign
R0708:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R0710:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R0927:Glra3 UTSW 8 56125204 missense possibly damaging 0.65
R1125:Glra3 UTSW 8 56039754 missense possibly damaging 0.69
R1138:Glra3 UTSW 8 56088976 splice site probably null
R1717:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1718:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1848:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1933:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1934:Glra3 UTSW 8 55940907 missense probably benign 0.07
R2042:Glra3 UTSW 8 56062459 missense probably benign 0.36
R2571:Glra3 UTSW 8 56110481 missense probably benign 0.41
R3123:Glra3 UTSW 8 56125209 missense possibly damaging 0.94
R3124:Glra3 UTSW 8 56125209 missense possibly damaging 0.94
R4585:Glra3 UTSW 8 56088993 missense probably damaging 1.00
R4981:Glra3 UTSW 8 55991235 missense possibly damaging 0.69
R5277:Glra3 UTSW 8 55991207 missense possibly damaging 0.79
R5356:Glra3 UTSW 8 55940901 missense probably benign 0.00
R6214:Glra3 UTSW 8 55991256 splice site probably null
R6941:Glra3 UTSW 8 55940926 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCACTCGCATATCTGTAGCCC -3'
(R):5'- AGCTTCCTCATTAACAAGTGGTTG -3'

Sequencing Primer
(F):5'- GCATATCTGTAGCCCTGTGAATC -3'
(R):5'- CAAGTGGTTGCAGATTAACACATTGG -3'
Posted On2015-09-25