Incidental Mutation 'R4593:Ldhd'
ID344217
Institutional Source Beutler Lab
Gene Symbol Ldhd
Ensembl Gene ENSMUSG00000031958
Gene Namelactate dehydrogenase D
SynonymsD8Bwg1320e, 4733401P21Rik
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111623785-111630374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111629364 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 129 (D129G)
Ref Sequence ENSEMBL: ENSMUSP00000068086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070004] [ENSMUST00000166859] [ENSMUST00000168428] [ENSMUST00000171182] [ENSMUST00000172856]
Predicted Effect probably damaging
Transcript: ENSMUST00000070004
AA Change: D129G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068086
Gene: ENSMUSG00000031958
AA Change: D129G

DomainStartEndE-ValueType
Pfam:FAD_binding_4 66 203 5.2e-38 PFAM
Pfam:FAD-oxidase_C 242 483 3.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166859
SMART Domains Protein: ENSMUSP00000132939
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 84 124 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168428
SMART Domains Protein: ENSMUSP00000126684
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171182
SMART Domains Protein: ENSMUSP00000127956
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 152 192 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172856
SMART Domains Protein: ENSMUSP00000133309
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173909
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Ldhd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ldhd APN 8 111628638 missense possibly damaging 0.61
IGL01372:Ldhd APN 8 111628400 missense probably benign
IGL02273:Ldhd APN 8 111627290 missense probably benign 0.37
IGL03111:Ldhd APN 8 111627165 missense probably damaging 1.00
R0511:Ldhd UTSW 8 111629677 missense probably benign 0.00
R0630:Ldhd UTSW 8 111627302 missense probably benign 0.00
R1468:Ldhd UTSW 8 111627293 missense possibly damaging 0.90
R1468:Ldhd UTSW 8 111627293 missense possibly damaging 0.90
R1682:Ldhd UTSW 8 111628113 missense possibly damaging 0.69
R2023:Ldhd UTSW 8 111629946 missense probably damaging 0.96
R2128:Ldhd UTSW 8 111627048 missense probably benign 0.37
R2131:Ldhd UTSW 8 111628537 unclassified probably null
R2180:Ldhd UTSW 8 111629386 missense probably benign 0.05
R5153:Ldhd UTSW 8 111627092 missense probably benign 0.06
R5747:Ldhd UTSW 8 111629071 missense probably damaging 1.00
R5796:Ldhd UTSW 8 111627090 missense probably benign 0.03
R6856:Ldhd UTSW 8 111630274 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCTGGGTCTAGAGAATGAAATGC -3'
(R):5'- CCATCCCAGAGCTTTGGTATG -3'

Sequencing Primer
(F):5'- AACTGCAGAGGCCCTTTC -3'
(R):5'- ATGGTTGCTGCAGGCCTC -3'
Posted On2015-09-25