Incidental Mutation 'R4593:Olfr393'
ID344222
Institutional Source Beutler Lab
Gene Symbol Olfr393
Ensembl Gene ENSMUSG00000094488
Gene Nameolfactory receptor 393
SynonymsGA_x6K02T2P1NL-4004140-4003208, MOR135-7
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73844413-73851454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73847314 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 270 (K270N)
Ref Sequence ENSEMBL: ENSMUSP00000150031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102523] [ENSMUST00000213365]
Predicted Effect probably benign
Transcript: ENSMUST00000102523
AA Change: K270N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099582
Gene: ENSMUSG00000094488
AA Change: K270N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.5e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.3e-7 PFAM
Pfam:7tm_1 41 290 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213365
AA Change: K270N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Olfr393
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Olfr393 APN 11 73847210 missense probably benign 0.00
IGL01845:Olfr393 APN 11 73847472 missense probably damaging 1.00
IGL01969:Olfr393 APN 11 73847609 missense possibly damaging 0.56
IGL02288:Olfr393 APN 11 73847381 missense possibly damaging 0.88
IGL02726:Olfr393 APN 11 73847865 missense probably benign 0.02
R0400:Olfr393 UTSW 11 73848041 missense probably benign 0.15
R1672:Olfr393 UTSW 11 73847955 missense probably benign 0.31
R1816:Olfr393 UTSW 11 73847199 missense probably benign 0.00
R2294:Olfr393 UTSW 11 73847486 missense probably damaging 1.00
R4506:Olfr393 UTSW 11 73847695 nonsense probably null
R4587:Olfr393 UTSW 11 73847219 missense probably benign 0.12
R5216:Olfr393 UTSW 11 73847436 missense probably damaging 0.97
R5657:Olfr393 UTSW 11 73847540 missense probably damaging 1.00
R5763:Olfr393 UTSW 11 73847867 missense probably benign 0.01
R5912:Olfr393 UTSW 11 73847675 missense possibly damaging 0.61
R6025:Olfr393 UTSW 11 73847919 missense probably benign 0.23
R6630:Olfr393 UTSW 11 73847876 missense probably benign
R6804:Olfr393 UTSW 11 73847414 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCTATGGTGAGAGACAATATC -3'
(R):5'- AAAGCTGTCCTGCTCAGACAC -3'

Sequencing Primer
(F):5'- ACTGCTGCCACTAAAGAG -3'
(R):5'- GTCCTGCTCAGACACTTATATTAATG -3'
Posted On2015-09-25