Incidental Mutation 'R4593:Atxn3'
ID344228
Institutional Source Beutler Lab
Gene Symbol Atxn3
Ensembl Gene ENSMUSG00000021189
Gene Nameataxin 3
SynonymsSca3, ataxin-3, Atx3, MJD1, 2210008M02Rik, Mjd
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location101918901-101958246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101923177 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 333 (M333K)
Ref Sequence ENSEMBL: ENSMUSP00000021606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021606]
Predicted Effect probably benign
Transcript: ENSMUST00000021606
AA Change: M333K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021606
Gene: ENSMUSG00000021189
AA Change: M333K

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 1.51e-3 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
UIM 329 348 7.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160186
SMART Domains Protein: ENSMUSP00000124178
Gene: ENSMUSG00000021189

DomainStartEndE-ValueType
UIM 2 21 2.23e-1 SMART
UIM 22 41 1.51e-3 SMART
low complexity region 54 64 N/A INTRINSIC
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Decreased exploratory behavior is reported for mice homozygous for a disruption of this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Atxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Atxn3 APN 12 101926508 missense possibly damaging 0.94
IGL01364:Atxn3 APN 12 101934423 splice site probably benign
IGL01393:Atxn3 APN 12 101933047 nonsense probably null
IGL01994:Atxn3 APN 12 101942180 missense probably benign
IGL03214:Atxn3 APN 12 101945922 splice site probably benign
R1081:Atxn3 UTSW 12 101934349 missense probably damaging 0.98
R1255:Atxn3 UTSW 12 101934334 missense probably damaging 1.00
R1288:Atxn3 UTSW 12 101942178 synonymous probably null
R1435:Atxn3 UTSW 12 101942201 missense probably benign 0.18
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R2032:Atxn3 UTSW 12 101942194 nonsense probably null
R2345:Atxn3 UTSW 12 101948321 missense probably damaging 1.00
R2882:Atxn3 UTSW 12 101937411 missense probably damaging 1.00
R4628:Atxn3 UTSW 12 101923078 unclassified probably benign
R4849:Atxn3 UTSW 12 101934368 missense probably benign 0.02
R4876:Atxn3 UTSW 12 101948379 missense probably damaging 1.00
R4960:Atxn3 UTSW 12 101948379 missense possibly damaging 0.92
R5682:Atxn3 UTSW 12 101958147 missense probably damaging 1.00
R6010:Atxn3 UTSW 12 101948026 missense probably damaging 1.00
R6520:Atxn3 UTSW 12 101934401 missense probably damaging 1.00
R6629:Atxn3 UTSW 12 101937406 missense probably benign 0.11
X0061:Atxn3 UTSW 12 101958139 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTACAAACCACTACAGTGTC -3'
(R):5'- AAGCGGGCACTAACTCTGTC -3'

Sequencing Primer
(F):5'- ACAAACCACTACAGTGTCTTTATCTC -3'
(R):5'- TGGGGATCTTGCAGAAGT -3'
Posted On2015-09-25