Incidental Mutation 'R4593:Vmn1r194'
ID344231
Institutional Source Beutler Lab
Gene Symbol Vmn1r194
Ensembl Gene ENSMUSG00000069297
Gene Namevomeronasal 1 receptor 194
SynonymsGm11294
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22244215-22245105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22244291 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 26 (M26K)
Ref Sequence ENSEMBL: ENSMUSP00000089331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091737
AA Change: M26K

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089331
Gene: ENSMUSG00000069297
AA Change: M26K

DomainStartEndE-ValueType
Pfam:V1R 35 296 3.4e-37 PFAM
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Vmn1r194
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Vmn1r194 APN 13 22244606 missense probably benign 0.01
IGL02140:Vmn1r194 APN 13 22244536 missense probably benign 0.08
R0066:Vmn1r194 UTSW 13 22244471 missense probably benign 0.33
R0066:Vmn1r194 UTSW 13 22244471 missense probably benign 0.33
R0109:Vmn1r194 UTSW 13 22245047 missense probably damaging 1.00
R0109:Vmn1r194 UTSW 13 22245047 missense probably damaging 1.00
R1276:Vmn1r194 UTSW 13 22244861 missense probably damaging 1.00
R1426:Vmn1r194 UTSW 13 22245066 missense probably damaging 0.99
R1620:Vmn1r194 UTSW 13 22244963 missense probably damaging 1.00
R4844:Vmn1r194 UTSW 13 22245053 missense probably benign 0.02
R5011:Vmn1r194 UTSW 13 22244888 missense probably benign 0.00
R5110:Vmn1r194 UTSW 13 22245000 missense probably benign 0.07
R5588:Vmn1r194 UTSW 13 22244342 missense possibly damaging 0.75
R5810:Vmn1r194 UTSW 13 22244427 nonsense probably null
R6648:Vmn1r194 UTSW 13 22244524 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCAGGAATCATTAAGGAAAGCCC -3'
(R):5'- CGTGCCATCCTTGCTAGATAAAC -3'

Sequencing Primer
(F):5'- GGAAAGCCCATATATGTTTACATCC -3'
(R):5'- TGCCATCCTTGCTAGATAAACTACAG -3'
Posted On2015-09-25