Incidental Mutation 'R4593:Dgat1'
ID344234
Institutional Source Beutler Lab
Gene Symbol Dgat1
Ensembl Gene ENSMUSG00000022555
Gene Namediacylglycerol O-acyltransferase 1
SynonymsD15Ertd23e
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76502015-76511953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76504689 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 111 (R111S)
Ref Sequence ENSEMBL: ENSMUSP00000023214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023214] [ENSMUST00000072838] [ENSMUST00000226860] [ENSMUST00000226872] [ENSMUST00000227478] [ENSMUST00000228371] [ENSMUST00000228757] [ENSMUST00000228868] [ENSMUST00000229363]
Predicted Effect probably damaging
Transcript: ENSMUST00000023214
AA Change: R111S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023214
Gene: ENSMUSG00000022555
AA Change: R111S

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
low complexity region 41 57 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
Pfam:MBOAT 162 485 8.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072838
SMART Domains Protein: ENSMUSP00000072617
Gene: ENSMUSG00000022556

DomainStartEndE-ValueType
HSF 14 118 2.27e-66 SMART
Pfam:Vert_HS_TF 247 414 6e-65 PFAM
Pfam:Vert_HS_TF 412 503 1.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160293
SMART Domains Protein: ENSMUSP00000123779
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
Pfam:MBOAT 41 201 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162813
Predicted Effect probably benign
Transcript: ENSMUST00000226238
Predicted Effect probably benign
Transcript: ENSMUST00000226860
Predicted Effect probably benign
Transcript: ENSMUST00000226872
Predicted Effect probably benign
Transcript: ENSMUST00000227478
Predicted Effect probably benign
Transcript: ENSMUST00000228371
Predicted Effect probably benign
Transcript: ENSMUST00000228688
Predicted Effect probably benign
Transcript: ENSMUST00000228757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228781
Predicted Effect probably benign
Transcript: ENSMUST00000228868
Predicted Effect probably benign
Transcript: ENSMUST00000229363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231035
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an multipass transmembrane protein that functions as a key metabolic enzyme. The encoded protein catalyzes the conversion of diacylglycerol and fatty acyl CoA to triacylglycerol. This enzyme can also transfer acyl CoA to retinol. Activity of this protein may be associated with obesity and other metabolic diseases. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased percent body fat, resistance to diet-induced obesity, altered energy, glucose and triglyceride metabolism, alopecia, hair cycle and skin defects, and a lactation failure associated with impaired mammary gland growth during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Dgat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Dgat1 APN 15 76503041 missense probably damaging 1.00
IGL02713:Dgat1 APN 15 76503534 missense probably damaging 1.00
R0510:Dgat1 UTSW 15 76511567 missense possibly damaging 0.85
R0894:Dgat1 UTSW 15 76502999 missense possibly damaging 0.55
R1525:Dgat1 UTSW 15 76511586 missense probably benign
R1682:Dgat1 UTSW 15 76503019 missense probably benign 0.03
R1740:Dgat1 UTSW 15 76502729 missense probably damaging 1.00
R1817:Dgat1 UTSW 15 76502503 missense probably damaging 1.00
R2352:Dgat1 UTSW 15 76502313 missense possibly damaging 0.66
R3012:Dgat1 UTSW 15 76503393 missense possibly damaging 0.90
R3154:Dgat1 UTSW 15 76502521 missense probably benign 0.27
R4059:Dgat1 UTSW 15 76504171 missense possibly damaging 0.79
R5503:Dgat1 UTSW 15 76502194 unclassified probably benign
R5818:Dgat1 UTSW 15 76502207 unclassified probably benign
R5984:Dgat1 UTSW 15 76502258 missense probably damaging 1.00
R6228:Dgat1 UTSW 15 76503293 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACCAATAATCACGCATGGGG -3'
(R):5'- CAGTACTTGGGCAAGGGTAG -3'

Sequencing Primer
(F):5'- CCAGCTGTAGGGGTCCTTCAG -3'
(R):5'- TAGGCAGCCGTCCTCTCAAC -3'
Posted On2015-09-25