Incidental Mutation 'R4593:Panx2'
ID344235
Institutional Source Beutler Lab
Gene Symbol Panx2
Ensembl Gene ENSMUSG00000058441
Gene Namepannexin 2
Synonyms
MMRRC Submission 041809-MU
Accession Numbers

Genbank: NM_001002005; MGI: 1890615

Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89059734-89073567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89067915 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 195 (I195T)
Ref Sequence ENSEMBL: ENSMUSP00000124354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161372] [ENSMUST00000162424]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159412
Predicted Effect probably benign
Transcript: ENSMUST00000159960
Predicted Effect probably damaging
Transcript: ENSMUST00000161372
AA Change: I203T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125514
Gene: ENSMUSG00000058441
AA Change: I203T

DomainStartEndE-ValueType
Pfam:Innexin 48 274 2.1e-11 PFAM
transmembrane domain 302 324 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161735
Predicted Effect probably damaging
Transcript: ENSMUST00000162424
AA Change: I195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124354
Gene: ENSMUSG00000058441
AA Change: I195T

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
Pfam:Innexin 49 263 5.6e-18 PFAM
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 421 430 N/A INTRINSIC
low complexity region 490 505 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162579
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 1 are abundantly expressed in central nervous system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 1 may form cell type-specific gap junctions with distinct properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a slight protection from the neurological defects induced by ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Panx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Panx2 APN 15 89068767 missense probably damaging 0.99
IGL02112:Panx2 APN 15 89069569 missense probably benign
IGL03384:Panx2 APN 15 89068119 missense possibly damaging 0.85
F6893:Panx2 UTSW 15 89068010 missense probably damaging 1.00
R0453:Panx2 UTSW 15 89068407 missense probably damaging 1.00
R1990:Panx2 UTSW 15 89069738 missense possibly damaging 0.95
R2912:Panx2 UTSW 15 89069821 missense probably benign 0.01
R3826:Panx2 UTSW 15 89068461 missense probably damaging 1.00
R4424:Panx2 UTSW 15 89068220 missense probably benign 0.02
R5176:Panx2 UTSW 15 89060228 missense probably damaging 1.00
R5328:Panx2 UTSW 15 89068095 missense probably damaging 0.99
R5333:Panx2 UTSW 15 89068539 missense possibly damaging 0.58
R5381:Panx2 UTSW 15 89060230 missense probably damaging 1.00
R5412:Panx2 UTSW 15 89068932 missense possibly damaging 0.79
R5450:Panx2 UTSW 15 89068959 missense possibly damaging 0.74
R5989:Panx2 UTSW 15 89060252 missense probably damaging 1.00
R6255:Panx2 UTSW 15 89067618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGCACAAGTTCCTGCCC -3'
(R):5'- GAACTCGTTCTGCTTCTGGG -3'

Sequencing Primer
(F):5'- ATCATGTATGTGCCCGCG -3'
(R):5'- GTGGCGTAGTATGTGCATAGGTAG -3'
Posted On2015-09-25