Incidental Mutation 'R4593:Cd86'
ID344236
Institutional Source Beutler Lab
Gene Symbol Cd86
Ensembl Gene ENSMUSG00000022901
Gene NameCD86 antigen
SynonymsB70, B7.2, Ly58, Cd28l2, Ly-58, MB7-2, B7-2
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location36603869-36666081 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 36606556 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 310 (*310R)
Ref Sequence ENSEMBL: ENSMUSP00000087047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089620]
Predicted Effect probably null
Transcript: ENSMUST00000089620
AA Change: *310R
SMART Domains Protein: ENSMUSP00000087047
Gene: ENSMUSG00000022901
AA Change: *310R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGv 35 112 1.76e-8 SMART
low complexity region 194 205 N/A INTRINSIC
transmembrane domain 246 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154485
Meta Mutation Damage Score 0.6508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice on an NOD background display a phenotype similar to human Guillain-Barre Syndrome, exhibiting severe peripheral nervous system inflammation, sciatic nerve demyelination, elevated auto-antibodies to myelin protein zero, hindlimb paralysis, and weak forelimb grip. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Cd86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Cd86 APN 16 36620953 missense probably benign 0.04
IGL01723:Cd86 APN 16 36607124 missense probably benign
IGL01834:Cd86 APN 16 36607119 missense probably benign 0.20
IGL02554:Cd86 APN 16 36618485 missense probably benign 0.01
IGL02714:Cd86 APN 16 36620928 missense possibly damaging 0.49
R0032:Cd86 UTSW 16 36620873 missense probably damaging 0.96
R0032:Cd86 UTSW 16 36620873 missense probably damaging 0.96
R0315:Cd86 UTSW 16 36620944 missense possibly damaging 0.88
R0494:Cd86 UTSW 16 36618637 splice site probably benign
R1345:Cd86 UTSW 16 36618324 splice site probably null
R1459:Cd86 UTSW 16 36628988 missense probably benign 0.09
R1616:Cd86 UTSW 16 36628976 missense probably benign 0.00
R4436:Cd86 UTSW 16 36620832 missense probably benign 0.04
R4612:Cd86 UTSW 16 36615330 missense probably benign 0.00
R6058:Cd86 UTSW 16 36629015 missense possibly damaging 0.91
R7140:Cd86 UTSW 16 36620901 missense probably benign 0.09
R7174:Cd86 UTSW 16 36606555 frame shift probably null
R7176:Cd86 UTSW 16 36606555 frame shift probably null
R7177:Cd86 UTSW 16 36606555 frame shift probably null
R7181:Cd86 UTSW 16 36606555 frame shift probably null
R7183:Cd86 UTSW 16 36606555 frame shift probably null
R7232:Cd86 UTSW 16 36606555 frame shift probably null
R7255:Cd86 UTSW 16 36606555 frame shift probably null
R7256:Cd86 UTSW 16 36606555 frame shift probably null
R7267:Cd86 UTSW 16 36606555 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACACTGCCACCTGTTTATGG -3'
(R):5'- AGGGTGGTTTTATGTCCAACATTAG -3'

Sequencing Primer
(F):5'- CACCTGTTTATGGCTACTTTCC -3'
(R):5'- TCCTGGGGATGCAGAAAA -3'
Posted On2015-09-25