Incidental Mutation 'R0064:Lpcat1'
ID34425
Institutional Source Beutler Lab
Gene Symbol Lpcat1
Ensembl Gene ENSMUSG00000021608
Gene Namelysophosphatidylcholine acyltransferase 1
Synonyms2900035H07Rik, Aytl2, rd11, LPCAT
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0064 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73467197-73516422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73514466 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 463 (N463K)
Ref Sequence ENSEMBL: ENSMUSP00000152190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022099] [ENSMUST00000123766] [ENSMUST00000147566] [ENSMUST00000223060]
Predicted Effect probably damaging
Transcript: ENSMUST00000022099
AA Change: N511K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022099
Gene: ENSMUSG00000021608
AA Change: N511K

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
PlsC 129 239 2.91e-25 SMART
Blast:PlsC 272 314 7e-9 BLAST
EFh 383 411 5.47e-1 SMART
EFh 420 448 4.98e1 SMART
EFh 455 483 4.93e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123766
SMART Domains Protein: ENSMUSP00000117965
Gene: ENSMUSG00000021608

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140431
Predicted Effect probably benign
Transcript: ENSMUST00000147566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222881
Predicted Effect probably damaging
Transcript: ENSMUST00000223060
AA Change: N463K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0492 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 1-acyl-sn-glycerol-3-phosphate acyltransferase family of proteins. The encoded enzyme plays a role in phospholipid metabolism, specifically in the conversion of lysophosphatidylcholine to phosphatidylcholine in the presence of acyl-CoA. This process is important in the synthesis of lung surfactant and platelet-activating factor (PAF). Elevated expression of this gene may contribute to the progression of oral squamous cell, prostate, breast, and other human cancers. [provided by RefSeq, Sep 2016]
PHENOTYPE: Some mice homozygous for a gene trapped allele exhibit neonatal lethality associated with respiratory distress, cyanosis, atelectasis, lung hemorrhage, and defective surfactant function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Lpcat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Lpcat1 APN 13 73494828 missense probably damaging 0.98
IGL02869:Lpcat1 APN 13 73484298 missense probably damaging 1.00
R1666:Lpcat1 UTSW 13 73510123 critical splice donor site probably null
R3826:Lpcat1 UTSW 13 73489093 missense possibly damaging 0.89
R3829:Lpcat1 UTSW 13 73489093 missense possibly damaging 0.89
R3830:Lpcat1 UTSW 13 73489093 missense possibly damaging 0.89
R4987:Lpcat1 UTSW 13 73489103 critical splice donor site probably null
R6298:Lpcat1 UTSW 13 73510955 missense possibly damaging 0.58
R7066:Lpcat1 UTSW 13 73511381 missense probably benign 0.00
R7165:Lpcat1 UTSW 13 73514530 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTAACCAGTGCCTGGTAATGGGG -3'
(R):5'- CAATGGGCAGATGGGACACACATAC -3'

Sequencing Primer
(F):5'- GGCTCTCTTGGGTCCCAATAATC -3'
(R):5'- GGCCCTGAGACAGACTTTACAG -3'
Posted On2013-05-09