Incidental Mutation 'R4594:Myom1'
ID344299
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4594 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71100074 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1064 (D1064G)
Ref Sequence ENSEMBL: ENSMUSP00000024847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: D1064G

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: D1064G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: D1162G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: D1162G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: D1064G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: D1064G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 intron probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 intron probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CTCTTAGCTGGCTGGGTTTATCAC -3'
(R):5'- ACTCCAAGAACTGCATTTGAAGG -3'

Sequencing Primer
(F):5'- GGGTTTATCACAAGTCCCAACTG -3'
(R):5'- CTGCATTTGAAGGATTATTTTAAGGC -3'
Posted On2015-09-25