Incidental Mutation 'R4595:Cfap46'
ID344322
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4595 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139652404 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 881 (D881V)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]
Predicted Effect possibly damaging
Transcript: ENSMUST00000129990
AA Change: D881V

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: D881V

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156116
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACTCTGTCAATGAGTGTCAG -3'
(R):5'- CCTTGTGGTGAAGATGCACTTG -3'

Sequencing Primer
(F):5'- CCCAGAGTTCAGATCTTGTGGAGAC -3'
(R):5'- TGAAGATGCACTTGTTTTAGGTC -3'
Posted On2015-09-25