Incidental Mutation 'R4595:Drd2'
ID344328
Institutional Source Beutler Lab
Gene Symbol Drd2
Ensembl Gene ENSMUSG00000032259
Gene Namedopamine receptor D2
SynonymsDrd-2, D2 receptor, D2R
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R4595 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49340627-49408177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49404789 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 283 (M283K)
Ref Sequence ENSEMBL: ENSMUSP00000075170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075764]
Predicted Effect probably benign
Transcript: ENSMUST00000075764
AA Change: M283K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000075170
Gene: ENSMUSG00000032259
AA Change: M283K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 45 238 2.5e-15 PFAM
Pfam:7tm_1 51 427 1.2e-88 PFAM
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D2 subtype of the dopamine receptor. This G-protein coupled receptor inhibits adenylyl cyclase activity. A missense mutation in this gene causes myoclonus dystonia; other mutations have been associated with schizophrenia. Alternative splicing of this gene results in two transcript variants encoding different isoforms. A third variant has been described, but it has not been determined whether this form is normal or due to aberrant splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show Parkinson's disease like symptoms, including akinetic and bradykinetic behavior. Mice lacking only the long isoform are hypoactive and exhibit increased sterotypic behavior in response to dopamine agonists. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Drd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Drd2 APN 9 49395758 missense probably damaging 1.00
IGL01407:Drd2 APN 9 49400815 missense probably damaging 1.00
IGL01669:Drd2 APN 9 49402089 missense possibly damaging 0.90
IGL02011:Drd2 APN 9 49406958 missense probably damaging 1.00
IGL02417:Drd2 APN 9 49402259 splice site probably benign
R0374:Drd2 UTSW 9 49399784 missense probably benign 0.41
R0402:Drd2 UTSW 9 49404971 missense probably benign 0.00
R0529:Drd2 UTSW 9 49407074 missense probably benign
R1124:Drd2 UTSW 9 49395640 missense probably damaging 0.98
R1458:Drd2 UTSW 9 49402212 missense probably damaging 1.00
R1807:Drd2 UTSW 9 49405067 missense probably damaging 1.00
R1888:Drd2 UTSW 9 49402142 missense probably benign 0.05
R1888:Drd2 UTSW 9 49402142 missense probably benign 0.05
R1971:Drd2 UTSW 9 49407059 missense probably damaging 1.00
R2192:Drd2 UTSW 9 49403271 missense probably benign 0.03
R2218:Drd2 UTSW 9 49399794 missense probably damaging 1.00
R3830:Drd2 UTSW 9 49402143 missense probably damaging 0.99
R4214:Drd2 UTSW 9 49404921 missense probably benign 0.00
R5392:Drd2 UTSW 9 49395628 missense possibly damaging 0.80
R5415:Drd2 UTSW 9 49402253 missense possibly damaging 0.81
R5598:Drd2 UTSW 9 49407015 missense possibly damaging 0.94
R5646:Drd2 UTSW 9 49404912 missense probably benign
R5715:Drd2 UTSW 9 49404889 missense probably benign 0.00
R5901:Drd2 UTSW 9 49406959 nonsense probably null
R6365:Drd2 UTSW 9 49406949 missense probably damaging 1.00
R6748:Drd2 UTSW 9 49403202 nonsense probably null
R7017:Drd2 UTSW 9 49400829 missense probably benign 0.32
X0022:Drd2 UTSW 9 49400781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCCGTGAGTTTGAGTG -3'
(R):5'- TCTCAAAGAACTTGGCAATCCTG -3'

Sequencing Primer
(F):5'- AGTGCTGTATTCAGATGGTCCC -3'
(R):5'- AATCCTGGGATTGACAATCTTGGC -3'
Posted On2015-09-25