Incidental Mutation 'R4596:Jak3'
ID344390
Institutional Source Beutler Lab
Gene Symbol Jak3
Ensembl Gene ENSMUSG00000031805
Gene NameJanus kinase 3
Synonymsfae; wil
MMRRC Submission 041812-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R4596 (G1)
Quality Score211
Status Not validated
Chromosome8
Chromosomal Location71676296-71690575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71684631 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 779 (S779T)
Ref Sequence ENSEMBL: ENSMUSP00000105640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034261] [ENSMUST00000051995] [ENSMUST00000110012] [ENSMUST00000110013]
Predicted Effect probably benign
Transcript: ENSMUST00000034261
SMART Domains Protein: ENSMUSP00000034261
Gene: ENSMUSG00000079019

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
IlGF 26 120 2.46e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000051995
AA Change: S779T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805
AA Change: S779T

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110012
AA Change: S779T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805
AA Change: S779T

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110013
AA Change: S779T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805
AA Change: S779T

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133263
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,805 K429E probably benign Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adad1 T C 3: 37,065,192 S141P probably damaging Het
Anapc4 T C 5: 52,841,718 V124A probably benign Het
Anxa6 G T 11: 54,994,583 probably null Het
Arhgef40 T C 14: 51,987,224 probably null Het
Asz1 A T 6: 18,103,593 I116K possibly damaging Het
Bcam T C 7: 19,764,157 N314D probably damaging Het
Cfi T C 3: 129,868,500 V376A probably damaging Het
Cipc A G 12: 86,961,954 T196A probably benign Het
Cnksr1 A G 4: 134,233,878 V225A possibly damaging Het
Col4a4 G A 1: 82,471,219 P1217S unknown Het
Dync2h1 C T 9: 6,992,595 D3996N probably benign Het
Fasl T C 1: 161,788,269 N6S probably benign Het
Fhod3 A T 18: 25,115,718 Q1318L probably benign Het
Gmps G T 3: 63,993,917 E386* probably null Het
Hspa13 C T 16: 75,758,226 G324D probably benign Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Itgb1bp1 C A 12: 21,272,134 L101F probably damaging Het
Klhl21 G T 4: 152,012,540 R421L probably benign Het
Mgat4c T C 10: 102,388,561 F212S probably damaging Het
Msl3l2 T A 10: 56,115,645 F155L probably benign Het
Nfat5 A G 8: 107,351,500 K406E possibly damaging Het
Nsd2 A T 5: 33,882,918 H933L probably damaging Het
Olfr1183 A G 2: 88,462,194 T304A probably benign Het
Olfr1497 G A 19: 13,794,900 T237I probably damaging Het
Olfr308 A T 7: 86,321,423 H176Q probably damaging Het
Olfr572 A G 7: 102,928,251 T208A possibly damaging Het
Paxbp1 T C 16: 91,030,547 I467V probably benign Het
Pcdha8 A C 18: 36,993,558 Q364H possibly damaging Het
Prr14l T C 5: 32,829,308 T948A probably benign Het
Ptgfr A T 3: 151,801,793 V311D probably damaging Het
Ptpn13 A G 5: 103,523,692 Y495C probably benign Het
Sec61g A T 11: 16,508,127 S23T probably benign Het
Sema3a G T 5: 13,570,157 V458F probably damaging Het
Slc16a14 T A 1: 84,929,357 E65D probably damaging Het
Slc35f6 T C 5: 30,648,062 M14T probably damaging Het
Slc4a10 A T 2: 62,296,858 I882F probably damaging Het
Sox17 C A 1: 4,492,637 E48D possibly damaging Het
Thbs1 A T 2: 118,114,755 I270F possibly damaging Het
Tia1 A G 6: 86,420,407 I121V probably benign Het
Trim30d A T 7: 104,472,526 H337Q probably benign Het
Tvp23b G A 11: 62,883,718 A63T probably benign Het
U2surp C T 9: 95,485,628 V437I probably damaging Het
Ube2i T C 17: 25,265,324 probably benign Het
Vmn1r62 A G 7: 5,675,307 probably benign Het
Wdr3 G A 3: 100,152,867 S310F possibly damaging Het
Wdr72 A T 9: 74,151,605 M327L probably benign Het
Other mutations in Jak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice site probably benign
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.24
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice site probably null
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 unclassified probably null
IGL02752:Jak3 APN 8 71682951 missense possibly damaging 0.50
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.15
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
citron UTSW 8 71686976 splice site probably benign
daniels UTSW 8 71681655 missense possibly damaging 0.48
Deposuit UTSW 8 71685404 missense probably damaging 1.00
distortion UTSW 8 71683978 missense probably damaging 1.00
Downcast UTSW 8 71685511 missense probably benign 0.07
fake_news UTSW 8 71685957 missense probably damaging 1.00
Implevit UTSW 8 71678773 missense probably benign
mount_tai UTSW 8 71683377 missense probably damaging 1.00
potentes UTSW 8 71686058 missense probably damaging 0.99
thistle UTSW 8 71685383 critical splice acceptor site probably null
thistle2 UTSW 8 71685545 missense probably damaging 1.00
PIT4403001:Jak3 UTSW 8 71684349 missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 71679642 missense probably benign 0.21
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0496:Jak3 UTSW 8 71682397 missense probably damaging 1.00
R0522:Jak3 UTSW 8 71682274 splice site probably benign
R0531:Jak3 UTSW 8 71686976 splice site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0612:Jak3 UTSW 8 71683377 missense probably damaging 1.00
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1183:Jak3 UTSW 8 71684550 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.75
R1793:Jak3 UTSW 8 71685946 splice site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense possibly damaging 0.95
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2058:Jak3 UTSW 8 71685383 critical splice acceptor site probably null
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 unclassified probably benign
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.48
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.99
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5538:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5799:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.68
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
R6260:Jak3 UTSW 8 71679310 missense probably benign 0.00
R6798:Jak3 UTSW 8 71680971 missense probably damaging 0.99
R7013:Jak3 UTSW 8 71678781 missense possibly damaging 0.88
R7070:Jak3 UTSW 8 71684611 missense probably damaging 1.00
R7122:Jak3 UTSW 8 71685957 missense probably damaging 1.00
R7166:Jak3 UTSW 8 71682316 missense probably damaging 1.00
R7225:Jak3 UTSW 8 71685511 missense probably benign 0.07
R7440:Jak3 UTSW 8 71680718 missense probably benign 0.02
R7489:Jak3 UTSW 8 71684292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAACCCTCGTCCCTTAG -3'
(R):5'- CTTGGATACCCTCAGATGAGAAC -3'

Sequencing Primer
(F):5'- CTCGTCCCTTAGAAGCTGAAG -3'
(R):5'- GAAATCCAGCCTGAGATGCTAGTTTG -3'
Posted On2015-09-25