Incidental Mutation 'R4597:Nipal4'
ID344460
Institutional Source Beutler Lab
Gene Symbol Nipal4
Ensembl Gene ENSMUSG00000020411
Gene NameNIPA-like domain containing 4
Synonyms
MMRRC Submission 041813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4597 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46148155-46166508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46151329 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 175 (V175A)
Ref Sequence ENSEMBL: ENSMUSP00000020679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400] [ENSMUST00000020679]
Predicted Effect probably benign
Transcript: ENSMUST00000011400
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000020679
AA Change: V175A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020679
Gene: ENSMUSG00000020411
AA Change: V175A

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 56 350 1.6e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144915
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a membrane receptor. Mutations in this gene have been associated with autosomal recessive congenital ichthyosis. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4931422A03Rik T A 2: 104,026,155 probably benign Het
Adh5 T C 3: 138,445,357 V27A probably damaging Het
Ank2 A T 3: 126,988,151 D843E probably damaging Het
Arid2 A G 15: 96,370,856 N950S probably damaging Het
Arl1 A T 10: 88,730,746 probably benign Het
Bcl3 T G 7: 19,812,503 I136L probably damaging Het
C130060K24Rik T C 6: 65,447,424 probably null Het
Car9 T A 4: 43,509,138 S235R probably damaging Het
Carnmt1 G T 19: 18,671,087 G30W probably damaging Het
Casp12 C T 9: 5,348,941 T101I possibly damaging Het
Cdh23 A G 10: 60,409,044 L1026P probably damaging Het
Clec10a A T 11: 70,169,980 Y186F probably damaging Het
Col22a1 G T 15: 71,964,662 A508E possibly damaging Het
Crocc G C 4: 141,019,777 S1573R probably damaging Het
Cttnbp2nl G T 3: 105,005,875 T231K possibly damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Ehbp1l1 T C 19: 5,717,927 E1116G possibly damaging Het
Fam83d T C 2: 158,785,222 V277A possibly damaging Het
Fga G T 3: 83,031,235 G306* probably null Het
Fkbp9 A G 6: 56,832,382 Y59C probably damaging Het
Frmpd1 A G 4: 45,274,441 T450A probably benign Het
Gabbr1 A G 17: 37,056,899 M414V possibly damaging Het
Gm15448 T A 7: 3,822,155 Y496F possibly damaging Het
Gm16506 A G 14: 43,725,115 F112L unknown Het
Gm27047 T C 6: 130,630,336 noncoding transcript Het
Gm4353 T A 7: 116,083,612 K245* probably null Het
Gm4950 A T 18: 51,865,793 I30N probably benign Het
Gm8298 T A 3: 59,876,793 M229K possibly damaging Het
H2-M10.2 T C 17: 36,285,393 T187A probably benign Het
H60c A T 10: 3,259,968 N106K possibly damaging Het
Hist1h1b A T 13: 21,780,511 V15E probably damaging Het
Hoxa6 T C 6: 52,208,407 probably null Het
Ighv1-74 A G 12: 115,802,656 C115R probably damaging Het
Il17a G A 1: 20,730,993 probably null Het
Itga9 T C 9: 118,843,514 Y199H probably damaging Het
Itpr3 C T 17: 27,093,283 R554C probably damaging Het
Kcnc3 T A 7: 44,595,816 M510K probably damaging Het
Kif15 A G 9: 122,993,849 T432A probably benign Het
Kif26b A T 1: 178,916,793 S1485C probably damaging Het
Klhl2 C A 8: 64,754,387 G313W probably damaging Het
Klhl32 C T 4: 24,629,339 S476N probably benign Het
Krt1 C T 15: 101,847,628 E386K possibly damaging Het
Lats1 T C 10: 7,691,746 S94P probably benign Het
Ltf G A 9: 111,022,933 C146Y probably damaging Het
Mars A G 10: 127,300,453 L501P probably damaging Het
Myh2 A C 11: 67,189,418 I1153L probably benign Het
Ncstn A T 1: 172,068,256 Y522* probably null Het
Olfr860 T C 9: 19,845,691 I309M probably benign Het
Pcdha1 C G 18: 36,931,906 A541G possibly damaging Het
Pex11g A G 8: 3,464,043 Y40H probably damaging Het
Rin2 G T 2: 145,860,905 R507L probably benign Het
Sh2b2 T C 5: 136,231,762 D200G probably damaging Het
Smg7 C A 1: 152,840,301 probably null Het
Snx17 T C 5: 31,198,513 probably benign Het
Sos1 T C 17: 80,433,826 Y510C probably benign Het
Spata31d1c T A 13: 65,035,613 L323* probably null Het
Supt16 C T 14: 52,173,589 G686D probably damaging Het
Szt2 C T 4: 118,372,681 R2751H unknown Het
Tnfsf8 A G 4: 63,837,100 L95P probably damaging Het
Vmn2r17 A G 5: 109,429,562 H493R probably benign Het
Zfp770 C T 2: 114,196,770 A273T possibly damaging Het
Other mutations in Nipal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02531:Nipal4 APN 11 46151325 missense probably damaging 1.00
IGL03203:Nipal4 APN 11 46150296 missense probably damaging 1.00
H8786:Nipal4 UTSW 11 46150477 missense probably damaging 1.00
R0239:Nipal4 UTSW 11 46150441 missense possibly damaging 0.80
R0239:Nipal4 UTSW 11 46150441 missense possibly damaging 0.80
R0331:Nipal4 UTSW 11 46150213 missense probably damaging 1.00
R0414:Nipal4 UTSW 11 46161908 missense probably damaging 1.00
R0613:Nipal4 UTSW 11 46150384 missense probably benign 0.31
R0940:Nipal4 UTSW 11 46150312 missense possibly damaging 0.48
R1797:Nipal4 UTSW 11 46151333 missense probably benign 0.06
R1889:Nipal4 UTSW 11 46150733 missense probably damaging 0.99
R1899:Nipal4 UTSW 11 46150231 missense probably damaging 1.00
R1974:Nipal4 UTSW 11 46151383 missense probably damaging 1.00
R2066:Nipal4 UTSW 11 46156795 missense probably damaging 1.00
R3705:Nipal4 UTSW 11 46161851 splice site probably benign
R3941:Nipal4 UTSW 11 46150646 missense probably damaging 1.00
R4965:Nipal4 UTSW 11 46162010 missense possibly damaging 0.68
R5888:Nipal4 UTSW 11 46151339 missense probably damaging 0.98
R6533:Nipal4 UTSW 11 46150407 nonsense probably null
X0018:Nipal4 UTSW 11 46162046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAGGTACCATCCAGCTTC -3'
(R):5'- GTTCTGGACTGTTGTTCTCCATAAG -3'

Sequencing Primer
(F):5'- AGGTACCATCCAGCTTCCTCTC -3'
(R):5'- TAAGTATTCACTCAACCCCCAGTGTG -3'
Posted On2015-09-25