Incidental Mutation 'R4597:2010111I01Rik'
ID344467
Institutional Source Beutler Lab
Gene Symbol 2010111I01Rik
Ensembl Gene ENSMUSG00000021458
Gene NameRIKEN cDNA 2010111I01 gene
SynonymsApO, aminopeptidase O
MMRRC Submission 041813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4597 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location62964893-63326096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63068092 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 393 (S393P)
Ref Sequence ENSEMBL: ENSMUSP00000089148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560]
Predicted Effect probably benign
Transcript: ENSMUST00000021911
AA Change: S392P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: S392P

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 221 359 5.4e-11 PFAM
Pfam:Peptidase_M1 385 558 2.3e-15 PFAM
Pfam:Peptidase_MA_2 453 613 1.3e-12 PFAM
Leuk-A4-hydro_C 675 821 3.02e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091560
AA Change: S393P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: S393P

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 220 359 2.7e-11 PFAM
Pfam:Peptidase_M1 386 561 1.9e-15 PFAM
Leuk-A4-hydro_C 676 822 3.02e-37 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220863
AA Change: S284P
Predicted Effect probably benign
Transcript: ENSMUST00000221676
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik T A 2: 104,026,155 probably benign Het
Adh5 T C 3: 138,445,357 V27A probably damaging Het
Ank2 A T 3: 126,988,151 D843E probably damaging Het
Arid2 A G 15: 96,370,856 N950S probably damaging Het
Arl1 A T 10: 88,730,746 probably benign Het
Bcl3 T G 7: 19,812,503 I136L probably damaging Het
C130060K24Rik T C 6: 65,447,424 probably null Het
Car9 T A 4: 43,509,138 S235R probably damaging Het
Carnmt1 G T 19: 18,671,087 G30W probably damaging Het
Casp12 C T 9: 5,348,941 T101I possibly damaging Het
Cdh23 A G 10: 60,409,044 L1026P probably damaging Het
Clec10a A T 11: 70,169,980 Y186F probably damaging Het
Col22a1 G T 15: 71,964,662 A508E possibly damaging Het
Crocc G C 4: 141,019,777 S1573R probably damaging Het
Cttnbp2nl G T 3: 105,005,875 T231K possibly damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Ehbp1l1 T C 19: 5,717,927 E1116G possibly damaging Het
Fam83d T C 2: 158,785,222 V277A possibly damaging Het
Fga G T 3: 83,031,235 G306* probably null Het
Fkbp9 A G 6: 56,832,382 Y59C probably damaging Het
Frmpd1 A G 4: 45,274,441 T450A probably benign Het
Gabbr1 A G 17: 37,056,899 M414V possibly damaging Het
Gm15448 T A 7: 3,822,155 Y496F possibly damaging Het
Gm16506 A G 14: 43,725,115 F112L unknown Het
Gm27047 T C 6: 130,630,336 noncoding transcript Het
Gm4353 T A 7: 116,083,612 K245* probably null Het
Gm4950 A T 18: 51,865,793 I30N probably benign Het
Gm8298 T A 3: 59,876,793 M229K possibly damaging Het
H2-M10.2 T C 17: 36,285,393 T187A probably benign Het
H60c A T 10: 3,259,968 N106K possibly damaging Het
Hist1h1b A T 13: 21,780,511 V15E probably damaging Het
Hoxa6 T C 6: 52,208,407 probably null Het
Ighv1-74 A G 12: 115,802,656 C115R probably damaging Het
Il17a G A 1: 20,730,993 probably null Het
Itga9 T C 9: 118,843,514 Y199H probably damaging Het
Itpr3 C T 17: 27,093,283 R554C probably damaging Het
Kcnc3 T A 7: 44,595,816 M510K probably damaging Het
Kif15 A G 9: 122,993,849 T432A probably benign Het
Kif26b A T 1: 178,916,793 S1485C probably damaging Het
Klhl2 C A 8: 64,754,387 G313W probably damaging Het
Klhl32 C T 4: 24,629,339 S476N probably benign Het
Krt1 C T 15: 101,847,628 E386K possibly damaging Het
Lats1 T C 10: 7,691,746 S94P probably benign Het
Ltf G A 9: 111,022,933 C146Y probably damaging Het
Mars A G 10: 127,300,453 L501P probably damaging Het
Myh2 A C 11: 67,189,418 I1153L probably benign Het
Ncstn A T 1: 172,068,256 Y522* probably null Het
Nipal4 A G 11: 46,151,329 V175A probably damaging Het
Olfr860 T C 9: 19,845,691 I309M probably benign Het
Pcdha1 C G 18: 36,931,906 A541G possibly damaging Het
Pex11g A G 8: 3,464,043 Y40H probably damaging Het
Rin2 G T 2: 145,860,905 R507L probably benign Het
Sh2b2 T C 5: 136,231,762 D200G probably damaging Het
Smg7 C A 1: 152,840,301 probably null Het
Snx17 T C 5: 31,198,513 probably benign Het
Sos1 T C 17: 80,433,826 Y510C probably benign Het
Spata31d1c T A 13: 65,035,613 L323* probably null Het
Supt16 C T 14: 52,173,589 G686D probably damaging Het
Szt2 C T 4: 118,372,681 R2751H unknown Het
Tnfsf8 A G 4: 63,837,100 L95P probably damaging Het
Vmn2r17 A G 5: 109,429,562 H493R probably benign Het
Zfp770 C T 2: 114,196,770 A273T possibly damaging Het
Other mutations in 2010111I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:2010111I01Rik APN 13 63199500 splice site probably benign
IGL00329:2010111I01Rik APN 13 63191163 missense probably damaging 1.00
IGL00336:2010111I01Rik APN 13 63015423 missense possibly damaging 0.78
IGL01384:2010111I01Rik APN 13 63190476 splice site probably benign
IGL01780:2010111I01Rik APN 13 63210125 missense probably benign 0.00
IGL01876:2010111I01Rik APN 13 63190522 missense probably damaging 1.00
IGL02096:2010111I01Rik APN 13 63061089 missense probably benign 0.04
IGL02166:2010111I01Rik APN 13 63015453 missense probably benign 0.02
IGL02184:2010111I01Rik APN 13 63068111 missense possibly damaging 0.50
R0139:2010111I01Rik UTSW 13 63190484 missense probably benign 0.01
R1209:2010111I01Rik UTSW 13 63191064 unclassified probably null
R1233:2010111I01Rik UTSW 13 63199520 missense probably damaging 0.96
R1756:2010111I01Rik UTSW 13 63068061 missense possibly damaging 0.95
R1786:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R1861:2010111I01Rik UTSW 13 63015783 missense probably damaging 1.00
R2130:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R2131:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R3076:2010111I01Rik UTSW 13 63240115 missense probably damaging 0.96
R3702:2010111I01Rik UTSW 13 63015330 missense probably benign 0.01
R3912:2010111I01Rik UTSW 13 63156706 nonsense probably null
R4512:2010111I01Rik UTSW 13 63156667 missense probably damaging 0.99
R4593:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4596:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4616:2010111I01Rik UTSW 13 63298751 missense probably damaging 1.00
R4625:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4627:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4630:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4632:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4911:2010111I01Rik UTSW 13 63170939 critical splice acceptor site probably null
R5204:2010111I01Rik UTSW 13 63033090 missense probably benign 0.15
R5210:2010111I01Rik UTSW 13 63068110 missense probably benign 0.00
R5849:2010111I01Rik UTSW 13 63015498 missense probably benign 0.00
R5861:2010111I01Rik UTSW 13 63298812 missense probably damaging 1.00
R5960:2010111I01Rik UTSW 13 63240273 missense probably damaging 0.99
R6021:2010111I01Rik UTSW 13 63061082 missense probably damaging 1.00
R6048:2010111I01Rik UTSW 13 63240325 missense probably damaging 0.99
R6379:2010111I01Rik UTSW 13 63068243 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTTCACTGCTGCCCAAAAGC -3'
(R):5'- AGCAGCATACCTGGCCATTC -3'

Sequencing Primer
(F):5'- CTGGGATTTGAACTCAGGACC -3'
(R):5'- TGGCCATTCCCAGACTTGG -3'
Posted On2015-09-25