Incidental Mutation 'R4609:Ugt1a10'
ID344485
Institutional Source Beutler Lab
Gene Symbol Ugt1a10
Ensembl Gene ENSMUSG00000090165
Gene NameUDP glycosyltransferase 1 family, polypeptide A10
SynonymsA13
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location88055388-88219004 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 88055482 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000108767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113142] [ENSMUST00000138182] [ENSMUST00000173325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113142
AA Change: M1L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138182
AA Change: M1L
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Ugt1a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Ugt1a10 APN 1 88055987 missense possibly damaging 0.72
IGL02219:Ugt1a10 APN 1 88056058 missense probably benign 0.00
IGL02511:Ugt1a10 APN 1 88055863 missense probably damaging 1.00
IGL02990:Ugt1a10 APN 1 88055879 missense probably damaging 1.00
PIT4142001:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R0201:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0201:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0522:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0525:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0554:Ugt1a10 UTSW 1 88056095 missense probably damaging 1.00
R0748:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0811:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R0812:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R1129:Ugt1a10 UTSW 1 88055609 missense probably benign
R1207:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R1432:Ugt1a10 UTSW 1 88216260 missense probably damaging 1.00
R1457:Ugt1a10 UTSW 1 88055711 missense probably damaging 1.00
R1469:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R1972:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R1973:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R2039:Ugt1a10 UTSW 1 88055981 missense probably benign 0.32
R2307:Ugt1a10 UTSW 1 88055947 missense probably benign 0.01
R3952:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R3973:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R4232:Ugt1a10 UTSW 1 88056210 missense probably benign 0.39
R4392:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4393:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4402:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4417:Ugt1a10 UTSW 1 88055995 missense probably benign
R4474:Ugt1a10 UTSW 1 88215928 intron probably benign
R4476:Ugt1a10 UTSW 1 88215928 intron probably benign
R4515:Ugt1a10 UTSW 1 88056197 missense probably damaging 1.00
R4579:Ugt1a10 UTSW 1 88056116 missense probably benign
R4582:Ugt1a10 UTSW 1 88055741 missense possibly damaging 0.90
R4627:Ugt1a10 UTSW 1 88218390 missense probably damaging 1.00
R4790:Ugt1a10 UTSW 1 88056287 missense probably damaging 0.98
R4799:Ugt1a10 UTSW 1 88215928 intron probably benign
R4910:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4915:Ugt1a10 UTSW 1 88055924 missense probably damaging 1.00
R5110:Ugt1a10 UTSW 1 88056252 splice site probably null
R5168:Ugt1a10 UTSW 1 88055809 missense probably benign 0.01
R5329:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R5373:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R5374:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R5615:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R6498:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R6727:Ugt1a10 UTSW 1 88056257 splice site probably null
R6809:Ugt1a10 UTSW 1 88055925 missense probably damaging 0.98
R6924:Ugt1a10 UTSW 1 88055657 missense probably damaging 0.99
R6967:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
S24628:Ugt1a10 UTSW 1 88216158 small deletion probably benign
X0013:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
Z1088:Ugt1a10 UTSW 1 88055842 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TTTTGTCAGGAGAGCACAAGATAG -3'
(R):5'- ACTCACCTCTGGGATGACTAC -3'

Sequencing Primer
(F):5'- CAGGAGAGCACAAGATAGTTATTTC -3'
(R):5'- TGGGATGACTACCACAACCTCATG -3'
Posted On2015-09-25