Incidental Mutation 'R4609:Dmxl2'
ID344521
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene NameDmx-like 2
SynonymsE130119P06Rik, 6430411K14Rik
MMRRC Submission 041820-MU
Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54365158-54501626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54446512 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 724 (L724P)
Ref Sequence ENSEMBL: ENSMUSP00000113705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600] [ENSMUST00000127880]
Predicted Effect probably damaging
Transcript: ENSMUST00000118163
AA Change: L724P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: L724P

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118600
AA Change: L724P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: L724P

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123709
SMART Domains Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
WD40 187 231 1.15e1 SMART
WD40 438 475 2.84e2 SMART
Pfam:Rav1p_C 632 1105 9.1e-72 PFAM
low complexity region 1180 1195 N/A INTRINSIC
coiled coil region 1319 1347 N/A INTRINSIC
low complexity region 1391 1406 N/A INTRINSIC
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1674 1692 N/A INTRINSIC
low complexity region 1925 1947 N/A INTRINSIC
WD40 1955 1990 5.73e0 SMART
WD40 1994 2033 8.88e0 SMART
WD40 2040 2082 2.67e-1 SMART
WD40 2088 2127 2.57e-2 SMART
WD40 2130 2169 3.61e-6 SMART
WD40 2182 2220 8.25e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127880
AA Change: L550P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122293
Gene: ENSMUSG00000041268
AA Change: L550P

DomainStartEndE-ValueType
Pfam:WD40 1 24 7.9e-4 PFAM
WD40 47 95 1.03e-1 SMART
low complexity region 246 266 N/A INTRINSIC
WD40 567 619 1.42e2 SMART
low complexity region 687 701 N/A INTRINSIC
low complexity region 771 787 N/A INTRINSIC
WD40 811 855 1.15e1 SMART
WD40 1062 1099 2.84e2 SMART
low complexity region 1252 1262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144736
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54401704 missense probably benign
IGL00226:Dmxl2 APN 9 54415993 missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54406667 missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54450838 missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54415422 unclassified probably benign
IGL00852:Dmxl2 APN 9 54423313 nonsense probably null
IGL00857:Dmxl2 APN 9 54376320 missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54416882 missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54458964 missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54415475 missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54445376 splice site probably benign
IGL01645:Dmxl2 APN 9 54378733 missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54401065 missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54404015 nonsense probably null
IGL02145:Dmxl2 APN 9 54374697 missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54404049 missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54445433 missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54393768 missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54393843 missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54393748 missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54406615 missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54366414 utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54416945 missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54404172 missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54416371 missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54404220 missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54446672 missense probably damaging 1.00
I2288:Dmxl2 UTSW 9 54401793 missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54401764 missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54378939 missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54399940 critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54416951 missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54383750 missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54393836 missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54405906 missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54419945 missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54382702 missense probably benign
R0626:Dmxl2 UTSW 9 54416554 missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54378817 missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54405828 missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54366440 missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54446412 missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54367765 missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54416433 missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54396249 missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54415428 critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54446988 nonsense probably null
R1609:Dmxl2 UTSW 9 54409263 missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54382027 missense probably benign
R1660:Dmxl2 UTSW 9 54451030 missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54401485 missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54423224 splice site probably benign
R1832:Dmxl2 UTSW 9 54460949 missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54401523 missense probably benign
R2104:Dmxl2 UTSW 9 54415564 missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54393813 missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54415910 missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54376243 missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54393862 missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54400094 missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54393702 missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54477461 missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54393643 missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54393769 missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54369878 missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54473832 splice site probably benign
R4004:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54379013 splice site probably null
R4014:Dmxl2 UTSW 9 54378709 splice site probably null
R4115:Dmxl2 UTSW 9 54446988 nonsense probably null
R4232:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54396267 missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54419884 missense probably null 0.17
R4552:Dmxl2 UTSW 9 54451763 missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54404120 missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54446905 missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54450924 missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54446405 unclassified probably null
R4746:Dmxl2 UTSW 9 54451796 missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54379815 missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54404041 missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54411653 missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54501441 utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54460987 missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54445484 unclassified probably null
R5288:Dmxl2 UTSW 9 54378757 missense probably benign
R5373:Dmxl2 UTSW 9 54369189 intron probably benign
R5374:Dmxl2 UTSW 9 54369189 intron probably benign
R5385:Dmxl2 UTSW 9 54378757 missense probably benign
R5386:Dmxl2 UTSW 9 54378757 missense probably benign
R5418:Dmxl2 UTSW 9 54374651 critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54393857 missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54423359 splice site probably null
R5733:Dmxl2 UTSW 9 54376266 missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54472964 missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54375508 missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54387420 missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54416753 missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54393727 missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54415762 missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54382706 missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54375536 missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54411624 missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54416088 missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54409183 missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54480380 missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54472212 missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54450879 missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54416729 missense probably benign 0.06
X0064:Dmxl2 UTSW 9 54401713 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCATTTTGTGAACCAAGCATGATG -3'
(R):5'- CCCATCATAATGCTCTGTTGAC -3'

Sequencing Primer
(F):5'- GGTGGCACATGCATTTAATCCCAG -3'
(R):5'- GACTCCTGAATCAGACTGTCAGTG -3'
Posted On2015-09-25