Incidental Mutation 'R0103:Dennd4c'
ID34456
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
MMRRC Submission 038389-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R0103 (G1)
Quality Score205
Status Validated (trace)
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86812446 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 860 (Y860C)
Ref Sequence ENSEMBL: ENSMUSP00000039860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect probably benign
Transcript: ENSMUST00000045512
AA Change: Y860C

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: Y860C

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082026
AA Change: Y860C

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: Y860C

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142837
AA Change: Y860C

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: Y860C

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,273,951 R443S probably damaging Het
Anapc1 T C 2: 128,680,452 probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arfgap3 A T 15: 83,322,721 probably benign Het
Asah2 G T 19: 32,018,977 H374N probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Ccdc106 C A 7: 5,057,545 Q35K probably benign Het
Ccm2l G T 2: 153,067,919 E64* probably null Het
Cep85l A T 10: 53,278,174 D776E possibly damaging Het
Cfap52 T A 11: 67,925,125 I611F possibly damaging Het
Cldn22 C T 8: 47,824,554 T9M probably benign Het
Coa7 T C 4: 108,338,141 L89P possibly damaging Het
Cox7a2l A T 17: 83,514,272 Y2N probably damaging Het
Ctns A C 11: 73,185,311 I299M probably damaging Het
Cyp27a1 A C 1: 74,735,915 E301A probably benign Het
Cyp2b13 A T 7: 26,088,710 K421M probably damaging Het
Cyp4f40 G T 17: 32,676,308 C468F probably damaging Het
Cyp4f40 C A 17: 32,676,309 C468* probably null Het
Dcun1d5 G A 9: 7,188,788 C74Y probably damaging Het
Dgkz T C 2: 91,934,205 T1028A probably benign Het
Dhx58 T C 11: 100,695,270 T642A probably damaging Het
Dlg4 A G 11: 70,031,193 Y87C probably damaging Het
Dnah6 C T 6: 73,092,172 E2511K probably damaging Het
Entpd5 C A 12: 84,396,943 E9* probably null Het
Fbln2 A C 6: 91,271,550 I1066L probably benign Het
Fhl2 C T 1: 43,153,221 R4H probably benign Het
Frmpd1 T A 4: 45,229,884 I17K probably damaging Het
Gbp7 T A 3: 142,546,538 N627K probably benign Het
Gm20388 A G 8: 122,269,733 probably benign Het
Gnptab A G 10: 88,429,519 Y331C probably damaging Het
Hdac4 T C 1: 91,975,644 E521G possibly damaging Het
Hibadh T A 6: 52,557,877 M173L probably benign Het
Iba57 C T 11: 59,163,613 A27T probably benign Het
Itga1 T C 13: 115,016,254 I211V probably benign Het
Keg1 A T 19: 12,718,916 I155F possibly damaging Het
Krt84 T C 15: 101,530,236 E272G probably damaging Het
Lrp2 C A 2: 69,477,040 V2892L probably benign Het
Ltb A G 17: 35,195,040 probably benign Het
Masp1 G A 16: 23,458,018 P579L probably damaging Het
Mtor T A 4: 148,533,902 M1724K probably benign Het
Myo3a T G 2: 22,544,322 probably benign Het
Myo9b C T 8: 71,323,849 probably benign Het
Ncor1 G T 11: 62,343,045 Q444K possibly damaging Het
Nek7 A T 1: 138,544,242 C53* probably null Het
Obscn G T 11: 59,062,696 Y4044* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Pcdh15 A T 10: 74,210,425 D178V probably damaging Het
Pcsk6 T C 7: 65,929,097 probably benign Het
Phxr4 T C 9: 13,431,791 probably benign Het
Pkhd1 T A 1: 20,523,359 D1510V probably benign Het
Pkhd1l1 T C 15: 44,597,141 C4249R probably benign Het
Plxnb2 A G 15: 89,161,769 Y968H possibly damaging Het
Prpf39 T C 12: 65,055,283 V378A possibly damaging Het
Psd2 A G 18: 36,004,717 N455S probably damaging Het
Ptch2 C A 4: 117,109,425 probably benign Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rad9b A T 5: 122,331,527 V348E probably damaging Het
Rcor1 T C 12: 111,109,778 probably benign Het
Rhoc A T 3: 104,791,991 E32V possibly damaging Het
Rnf40 T G 7: 127,600,571 V925G probably damaging Het
Rptor G T 11: 119,884,967 R988L probably benign Het
Slc25a32 A T 15: 39,099,897 Y176* probably null Het
Slc7a1 T A 5: 148,352,426 K4* probably null Het
Ss18 A C 18: 14,679,421 Y38D probably damaging Het
Syt4 T A 18: 31,447,220 probably benign Het
Taar4 A T 10: 23,961,406 N305Y probably damaging Het
Taar7b A T 10: 24,000,294 Y119F probably benign Het
Tcaf1 G T 6: 42,686,390 D185E probably benign Het
Tmem138 T C 19: 10,574,952 N62S possibly damaging Het
Tnfaip2 C T 12: 111,445,810 T215M probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnfrsf25 C T 4: 152,116,948 P65S possibly damaging Het
Trp53bp1 A T 2: 121,236,759 S495R possibly damaging Het
Trpv3 T C 11: 73,293,979 F597S probably damaging Het
Tsc22d4 A C 5: 137,747,116 M1L possibly damaging Het
Ttc39a A G 4: 109,421,453 probably null Het
Ttn T G 2: 76,761,226 H21033P probably damaging Het
Ugt2a3 A G 5: 87,336,718 V149A possibly damaging Het
Ush2a T G 1: 188,319,070 I251R possibly damaging Het
Vamp4 T C 1: 162,589,539 C114R possibly damaging Het
Wdr33 T C 18: 31,833,335 V135A probably damaging Het
Zc3h13 T A 14: 75,330,468 V1067E probably damaging Het
Zcwpw1 G A 5: 137,810,113 W274* probably null Het
Zfp219 T A 14: 52,006,706 H627L probably damaging Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAACCACCCTGATTGAGTAGAACC -3'
(R):5'- TGACAAATatgtgaagaggactttgcacc -3'

Sequencing Primer
(F):5'- GTCATGCAGCTTTGTGGACT -3'
(R):5'- acacaaaacaaaacaaacaaacaaac -3'
Posted On2013-05-09