Incidental Mutation 'R4610:Myo9a'
ID344624
Institutional Source Beutler Lab
Gene Symbol Myo9a
Ensembl Gene ENSMUSG00000039585
Gene Namemyosin IXa
SynonymsC130068I12Rik, 4732465J09Rik
MMRRC Submission 041821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4610 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59750896-59928866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59871882 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1640 (H1640Q)
Ref Sequence ENSEMBL: ENSMUSP00000122852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]
Predicted Effect probably benign
Transcript: ENSMUST00000128341
AA Change: H1640Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: H1640Q

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
Blast:MYSc 1685 1938 6e-89 BLAST
low complexity region 1982 1993 N/A INTRINSIC
C1 2002 2050 2.6e-9 SMART
RhoGAP 2075 2250 3.36e-73 SMART
coiled coil region 2320 2360 N/A INTRINSIC
low complexity region 2419 2438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135298
AA Change: H1640Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: H1640Q

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2391 2431 N/A INTRINSIC
low complexity region 2490 2509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136740
AA Change: H1640Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: H1640Q

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2409 2449 N/A INTRINSIC
low complexity region 2508 2527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215963
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Adgre1 C A 17: 57,450,073 Q777K possibly damaging Het
Agpat4 G A 17: 12,210,377 probably null Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankle1 AT A 8: 71,407,207 probably benign Het
Ankrd44 T G 1: 54,766,748 probably benign Het
Aprt A T 8: 122,575,415 probably null Het
Aptx T C 4: 40,702,766 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Cacng7 T A 7: 3,336,691 M36K probably benign Het
Camta1 A G 4: 151,084,827 W156R probably damaging Het
Casd1 G A 6: 4,631,165 probably null Het
Casz1 T A 4: 148,933,267 Y338N probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cit A G 5: 115,994,087 T1801A probably benign Het
Cnot2 A G 10: 116,499,418 I275T probably damaging Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dst T C 1: 34,169,856 L820P probably damaging Het
Dusp11 T A 6: 85,950,055 N193Y probably damaging Het
Eif3m A T 2: 105,013,288 N116K probably benign Het
Epb41l1 A T 2: 156,509,261 E418D possibly damaging Het
Esyt2 T G 12: 116,318,890 N153K probably damaging Het
Exoc6b T G 6: 85,003,159 probably benign Het
Ezr C T 17: 6,739,722 E502K possibly damaging Het
Fbxw11 T A 11: 32,711,859 Y66N possibly damaging Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Fry T C 5: 150,386,104 L671P probably damaging Het
Galnt7 A G 8: 57,545,769 I262T probably damaging Het
Glp1r T C 17: 30,931,247 F381S probably benign Het
Gm3867 T C 9: 36,257,271 noncoding transcript Het
Gm5662 T C 12: 88,271,774 N72S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gstm7 G A 3: 107,926,919 T206I possibly damaging Het
Hist1h2bf A T 13: 23,574,057 V45E possibly damaging Het
Hs3st5 A T 10: 36,828,806 D35V probably benign Het
Hspa13 T C 16: 75,761,302 H125R probably benign Het
Hspa1a T G 17: 34,971,180 H249P probably damaging Het
Igkv10-95 A T 6: 68,680,578 Q6L probably damaging Het
Il1rap T A 16: 26,714,776 L474H probably benign Het
Ipo11 T A 13: 106,879,737 Y489F probably benign Het
Itga5 A G 15: 103,350,832 Y723H probably damaging Het
Itih2 T C 2: 10,105,160 N594S probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Kif26b A G 1: 178,679,355 Y332C probably damaging Het
Kmt2c G A 5: 25,354,384 R1086W probably damaging Het
Ktn1 T A 14: 47,726,179 probably benign Het
Lars2 T A 9: 123,418,693 I305N probably damaging Het
Lgmn G T 12: 102,400,124 probably benign Het
Ltbp4 C T 7: 27,306,700 E1453K probably damaging Het
Lypd8 G A 11: 58,386,849 M152I probably benign Het
Man2a1 T A 17: 64,712,459 S773T probably benign Het
Map2k6 T G 11: 110,499,474 L278R probably damaging Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mms19 A G 19: 41,945,496 V811A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtcl1 T A 17: 66,377,887 H520L probably benign Het
Mymk A T 2: 27,062,707 F130I probably damaging Het
Myo1f C T 17: 33,582,332 R333C probably damaging Het
Nav1 A G 1: 135,592,448 probably benign Het
Ncbp3 G T 11: 73,079,018 G564C probably damaging Het
Ncoa4 A T 14: 32,176,725 I501L probably benign Het
Ngp T A 9: 110,420,815 N60K possibly damaging Het
Npc1l1 G T 11: 6,228,215 D398E probably damaging Het
Nphs2 T A 1: 156,326,131 M264K probably damaging Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr58 T A 9: 19,783,146 Y4* probably null Het
Patz1 A G 11: 3,306,241 Y509C probably damaging Het
Pax8 G A 2: 24,421,583 P447S probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Pex11g C T 8: 3,465,899 V45M probably benign Het
Pik3ip1 T A 11: 3,333,327 S142R probably damaging Het
Pitpnm2 C G 5: 124,125,371 A819P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plin4 T A 17: 56,105,418 M538L probably benign Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rev1 T C 1: 38,053,649 E1202G probably damaging Het
Rngtt T A 4: 33,339,133 probably benign Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgsm1 A T 5: 113,255,307 F958Y probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorl1 C T 9: 42,031,914 V889M possibly damaging Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stam A T 2: 14,115,858 H53L probably damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tarbp1 A G 8: 126,474,330 Y246H probably damaging Het
Tbx15 A G 3: 99,352,367 Y518C probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tescl T C 7: 24,333,258 E214G probably damaging Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tmem132d A G 5: 127,984,296 V414A probably benign Het
Tmem41b T A 7: 109,974,734 probably benign Het
Tnfrsf18 A G 4: 156,021,880 probably benign Het
Tulp4 T A 17: 6,198,833 D42E probably damaging Het
Ubtd1 A G 19: 42,033,664 N125S probably damaging Het
Ubxn4 T A 1: 128,255,449 F68I probably benign Het
Urb1 A G 16: 90,776,271 S958P probably benign Het
Vash2 T C 1: 190,960,301 S226G probably benign Het
Vmn2r120 C T 17: 57,509,120 G745E probably damaging Het
Vmn2r58 T A 7: 41,837,693 I593F probably benign Het
Zfp398 T C 6: 47,840,427 L67P probably damaging Het
Zfp607b T A 7: 27,703,695 H525Q probably damaging Het
Zfp629 T C 7: 127,612,320 T106A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zic5 T A 14: 122,464,800 D173V probably damaging Het
Zranb2 G A 3: 157,541,884 probably benign Het
Other mutations in Myo9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myo9a APN 9 59843059 splice site probably benign
IGL00510:Myo9a APN 9 59832181 splice site probably benign
IGL00710:Myo9a APN 9 59875311 missense probably damaging 1.00
IGL00963:Myo9a APN 9 59900372 missense probably damaging 0.98
IGL01087:Myo9a APN 9 59790078 missense possibly damaging 0.93
IGL01145:Myo9a APN 9 59855375 missense probably benign 0.18
IGL01403:Myo9a APN 9 59871563 missense probably damaging 0.98
IGL01528:Myo9a APN 9 59779674 missense probably damaging 1.00
IGL01608:Myo9a APN 9 59870836 nonsense probably null
IGL01701:Myo9a APN 9 59884594 critical splice donor site probably null
IGL01918:Myo9a APN 9 59779702 missense probably damaging 1.00
IGL02026:Myo9a APN 9 59905962 missense probably damaging 0.99
IGL02139:Myo9a APN 9 59779992 missense probably benign 0.07
IGL02176:Myo9a APN 9 59870553 missense probably benign 0.45
IGL02272:Myo9a APN 9 59884600 splice site probably benign
IGL02283:Myo9a APN 9 59871673 missense probably benign 0.00
IGL02499:Myo9a APN 9 59815386 splice site probably benign
IGL02652:Myo9a APN 9 59863928 missense probably damaging 1.00
IGL02666:Myo9a APN 9 59924904 missense probably benign 0.02
IGL02878:Myo9a APN 9 59908300 critical splice donor site probably null
IGL02982:Myo9a APN 9 59908208 nonsense probably null
IGL03072:Myo9a APN 9 59809442 missense possibly damaging 0.83
IGL03090:Myo9a APN 9 59894135 splice site probably benign
IGL03111:Myo9a APN 9 59827243 missense probably benign 0.19
IGL03389:Myo9a APN 9 59869607 missense probably damaging 1.00
essentials UTSW 9 59894866 missense probably benign 0.09
necessities UTSW 9 59815334 missense probably damaging 1.00
PIT4402001:Myo9a UTSW 9 59870436 missense possibly damaging 0.83
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0329:Myo9a UTSW 9 59923677 missense probably damaging 1.00
R0423:Myo9a UTSW 9 59895336 missense probably damaging 1.00
R0521:Myo9a UTSW 9 59894352 missense probably damaging 1.00
R0607:Myo9a UTSW 9 59921793 missense probably benign 0.02
R0652:Myo9a UTSW 9 59871926 missense probably benign
R0653:Myo9a UTSW 9 59924991 missense probably damaging 1.00
R0723:Myo9a UTSW 9 59871100 missense probably benign 0.01
R0784:Myo9a UTSW 9 59896545 splice site probably benign
R0842:Myo9a UTSW 9 59871067 missense probably benign 0.02
R1055:Myo9a UTSW 9 59855370 missense probably benign 0.01
R1056:Myo9a UTSW 9 59832201 missense possibly damaging 0.64
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1615:Myo9a UTSW 9 59788456 missense possibly damaging 0.68
R1698:Myo9a UTSW 9 59868181 missense probably benign 0.05
R1715:Myo9a UTSW 9 59832300 missense probably damaging 0.99
R1981:Myo9a UTSW 9 59894146 missense probably benign
R2228:Myo9a UTSW 9 59894180 missense probably benign 0.06
R2272:Myo9a UTSW 9 59815301 missense probably damaging 1.00
R2327:Myo9a UTSW 9 59779765 missense probably benign 0.11
R2990:Myo9a UTSW 9 59924889 missense possibly damaging 0.95
R3161:Myo9a UTSW 9 59832315 splice site probably benign
R3721:Myo9a UTSW 9 59868180 missense probably benign
R3928:Myo9a UTSW 9 59895283 missense probably damaging 1.00
R4197:Myo9a UTSW 9 59894866 missense probably benign 0.09
R4212:Myo9a UTSW 9 59906066 nonsense probably null
R4616:Myo9a UTSW 9 59821649 missense probably damaging 1.00
R4621:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4623:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4632:Myo9a UTSW 9 59869664 missense probably benign 0.00
R4657:Myo9a UTSW 9 59875416 critical splice donor site probably null
R4892:Myo9a UTSW 9 59824242 missense probably damaging 0.98
R4897:Myo9a UTSW 9 59896517 missense probably benign 0.07
R4966:Myo9a UTSW 9 59871734 missense probably benign 0.00
R4993:Myo9a UTSW 9 59861472 nonsense probably null
R5160:Myo9a UTSW 9 59871802 missense probably benign 0.24
R5233:Myo9a UTSW 9 59910617 missense probably damaging 1.00
R5271:Myo9a UTSW 9 59907382 missense probably damaging 1.00
R5308:Myo9a UTSW 9 59863961 missense probably damaging 1.00
R5367:Myo9a UTSW 9 59900449 missense probably damaging 0.96
R5432:Myo9a UTSW 9 59865670 missense possibly damaging 0.94
R5459:Myo9a UTSW 9 59884520 missense probably damaging 0.98
R5511:Myo9a UTSW 9 59780212 missense probably damaging 1.00
R5568:Myo9a UTSW 9 59874628 missense probably benign
R5573:Myo9a UTSW 9 59871001 missense probably benign
R5589:Myo9a UTSW 9 59895244 nonsense probably null
R5607:Myo9a UTSW 9 59863944 missense probably damaging 1.00
R5633:Myo9a UTSW 9 59868184 missense possibly damaging 0.60
R5885:Myo9a UTSW 9 59871220 missense probably benign
R6024:Myo9a UTSW 9 59855388 missense possibly damaging 0.68
R6086:Myo9a UTSW 9 59790057 nonsense probably null
R6146:Myo9a UTSW 9 59871229 missense probably benign 0.01
R6194:Myo9a UTSW 9 59869750 missense probably benign 0.00
R6213:Myo9a UTSW 9 59827258 missense probably damaging 1.00
R6368:Myo9a UTSW 9 59924948 missense probably benign 0.01
R6550:Myo9a UTSW 9 59868199 missense probably damaging 1.00
R6612:Myo9a UTSW 9 59827196 missense probably damaging 1.00
R6665:Myo9a UTSW 9 59871872 missense probably benign 0.09
R6951:Myo9a UTSW 9 59894768 missense probably damaging 1.00
R7026:Myo9a UTSW 9 59815334 missense probably damaging 1.00
R7107:Myo9a UTSW 9 59870815 missense probably benign 0.44
R7310:Myo9a UTSW 9 59871153 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TAGGTTCCCCATCAGCAGTC -3'
(R):5'- CAGCATTCATGTACACAGAGC -3'

Sequencing Primer
(F):5'- GTCACTAAAAGAGACGCAGCTCTTG -3'
(R):5'- TATGTGAGAAATTCCCCCACTTAAC -3'
Posted On2015-09-25