Incidental Mutation 'R4611:Celf2'
ID344680
Institutional Source Beutler Lab
Gene Symbol Celf2
Ensembl Gene ENSMUSG00000002107
Gene NameCUGBP, Elav-like family member 2
SynonymsNapor-2, ETR-3, B230345P09Rik, Cugbp2
MMRRC Submission 041822-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R4611 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location6539694-7509563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6586020 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 279 (N279K)
Ref Sequence ENSEMBL: ENSMUSP00000138297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002176] [ENSMUST00000100429] [ENSMUST00000114924] [ENSMUST00000114927] [ENSMUST00000114934] [ENSMUST00000142941] [ENSMUST00000150624] [ENSMUST00000170438] [ENSMUST00000182404] [ENSMUST00000182706] [ENSMUST00000182851] [ENSMUST00000182879] [ENSMUST00000183091] [ENSMUST00000183209] [ENSMUST00000183984]
Predicted Effect probably benign
Transcript: ENSMUST00000002176
AA Change: N279K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002176
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 326 355 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
RRM 400 473 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100429
AA Change: N279K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097996
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114924
AA Change: N321K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110574
Gene: ENSMUSG00000002107
AA Change: N321K

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114927
AA Change: N279K

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110577
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114934
AA Change: N321K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110584
Gene: ENSMUSG00000002107
AA Change: N321K

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142941
AA Change: N279K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120459
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150624
AA Change: N279K

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138297
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170438
AA Change: N321K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000130829
Gene: ENSMUSG00000002107
AA Change: N321K

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
RRM 384 467 4.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182355
Predicted Effect probably benign
Transcript: ENSMUST00000182404
AA Change: N192K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138769
Gene: ENSMUSG00000002107
AA Change: N192K

DomainStartEndE-ValueType
RRM 22 97 4.22e-22 SMART
low complexity region 107 136 N/A INTRINSIC
low complexity region 165 192 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 254 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182706
AA Change: N315K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000138764
Gene: ENSMUSG00000002107
AA Change: N315K

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 362 391 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
RRM 436 509 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182851
AA Change: N303K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138363
Gene: ENSMUSG00000002107
AA Change: N303K

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
low complexity region 350 379 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
RRM 424 497 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182879
AA Change: N279K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138359
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
RRM 346 429 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183091
AA Change: N303K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138795
Gene: ENSMUSG00000002107
AA Change: N303K

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
RRM 366 449 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183209
AA Change: N315K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138355
Gene: ENSMUSG00000002107
AA Change: N315K

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
RRM 378 461 4.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183269
Predicted Effect probably benign
Transcript: ENSMUST00000183984
AA Change: N366K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138974
Gene: ENSMUSG00000002107
AA Change: N366K

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
RRM 104 182 1.29e-17 SMART
RRM 196 271 4.22e-22 SMART
low complexity region 281 310 N/A INTRINSIC
low complexity region 339 366 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,393 R200C probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Apc T C 18: 34,318,565 L2804P probably damaging Het
Apob C A 12: 8,011,331 A3271E probably damaging Het
Asl G T 5: 130,018,316 A147E probably damaging Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bcl11b T C 12: 107,916,530 K509E probably damaging Het
Btnl1 T C 17: 34,379,725 I105T probably damaging Het
Btnl10 A G 11: 58,920,357 T169A probably damaging Het
C8b T C 4: 104,790,644 I278T probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd8b1 T C 6: 71,332,475 V181A probably benign Het
Cdan1 A T 2: 120,730,720 V189D probably damaging Het
Cfap52 T C 11: 67,926,421 N549D probably damaging Het
Cmklr1 C T 5: 113,614,869 V24M probably benign Het
Cntnap4 G T 8: 112,773,739 probably null Het
Col27a1 G A 4: 63,293,506 G91R probably damaging Het
Col5a3 A G 9: 20,814,896 probably benign Het
Dcc C T 18: 71,548,998 probably null Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah8 T A 17: 30,684,237 L950H probably damaging Het
Dnajc7 A T 11: 100,590,977 Y228* probably null Het
Doxl2 A T 6: 48,975,156 Q5L probably benign Het
Eno1b T C 18: 48,047,703 V316A probably damaging Het
Exoc4 T C 6: 33,438,405 M404T possibly damaging Het
Fignl1 A T 11: 11,801,268 C596S probably benign Het
Fn1 A C 1: 71,624,178 Y1050* probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gba2 T A 4: 43,568,092 S732C probably damaging Het
Gcnt4 C A 13: 96,946,482 S95R probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gria2 A T 3: 80,692,492 M695K probably damaging Het
Hoxa9 T C 6: 52,225,710 K132R probably damaging Het
Ifi213 T A 1: 173,589,914 T311S possibly damaging Het
Itgb2 T A 10: 77,550,050 N282K probably damaging Het
Kcnh8 A T 17: 52,602,836 Q11L probably benign Het
Klk14 T C 7: 43,694,357 C163R probably damaging Het
Klk1b3 T A 7: 44,201,265 W74R possibly damaging Het
Krtap13-1 G T 16: 88,729,254 C122F possibly damaging Het
Luzp2 T C 7: 55,063,356 probably null Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtor T A 4: 148,486,119 V1211E probably benign Het
Myb T A 10: 21,145,324 D402V probably damaging Het
Ncor2 G A 5: 125,030,859 T1593I probably damaging Het
Ndst3 A G 3: 123,671,549 I258T probably benign Het
Npy6r C A 18: 44,276,401 H296Q probably damaging Het
Olfml2b T A 1: 170,644,947 L9H probably damaging Het
Olfr1364 A T 13: 21,573,574 V294D probably damaging Het
Olfr1442 T A 19: 12,674,954 Y250N probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr1475 C T 19: 13,480,012 C62Y probably damaging Het
Olfr43 A T 11: 74,206,535 V227D possibly damaging Het
Olfr519 A G 7: 108,894,117 C97R probably damaging Het
Olfr727 C A 14: 50,127,073 N165K probably benign Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parg G A 14: 32,274,864 R304Q probably damaging Het
Pdf T G 8: 107,048,535 S22R probably benign Het
Phlpp2 A T 8: 109,876,883 R60S possibly damaging Het
Piwil2 C T 14: 70,402,197 E401K probably benign Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Polr3a T C 14: 24,452,508 probably null Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ptch2 G A 4: 117,110,378 D748N probably benign Het
Rai14 A C 15: 10,592,138 Y224D probably damaging Het
Rft1 A G 14: 30,689,790 I432V probably damaging Het
Rictor C T 15: 6,787,144 A1299V possibly damaging Het
Sall2 A G 14: 52,313,753 C662R probably damaging Het
Scn4b A G 9: 45,150,439 N208D probably damaging Het
Sdhb G A 4: 140,972,915 G109R probably damaging Het
Sec16a A G 2: 26,441,805 V66A probably benign Het
Sema4g A G 19: 45,001,612 Y710C probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Shc4 T A 2: 125,655,682 D369V probably benign Het
Siglech T C 7: 55,771,693 L285P probably damaging Het
Skint6 A G 4: 113,074,076 M506T probably benign Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Slfn14 T A 11: 83,283,314 K284* probably null Het
Sox14 A G 9: 99,875,662 I8T probably damaging Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Tdpoz3 A T 3: 93,827,023 H335L probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tnik T C 3: 28,542,100 probably null Het
Tnpo2 T C 8: 85,053,803 S720P probably benign Het
Tpst1 A G 5: 130,101,706 K6E probably damaging Het
Trank1 T A 9: 111,362,261 I446N probably damaging Het
Trmt44 A T 5: 35,575,007 D13E probably benign Het
Ubr4 T A 4: 139,399,579 V471E possibly damaging Het
Ubtd1 A G 19: 42,033,591 T101A probably benign Het
Ugt3a1 A T 15: 9,306,400 K212* probably null Het
Zbtb7c C T 18: 76,136,847 A2V possibly damaging Het
Zfp423 C T 8: 87,688,081 G1182D possibly damaging Het
Zfp618 G A 4: 63,132,979 V666M probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Zscan20 T C 4: 128,588,106 T588A probably benign Het
Zscan25 G A 5: 145,291,116 R530H probably damaging Het
Other mutations in Celf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Celf2 APN 2 6721577 missense probably benign 0.00
IGL01974:Celf2 APN 2 6604031 missense probably damaging 1.00
IGL02159:Celf2 APN 2 6604177 nonsense probably null
LCD18:Celf2 UTSW 2 6779076 intron probably benign
R0113:Celf2 UTSW 2 6624714 missense probably damaging 1.00
R0511:Celf2 UTSW 2 6604176 missense probably damaging 1.00
R0711:Celf2 UTSW 2 6721415 critical splice donor site probably null
R1755:Celf2 UTSW 2 6884958 start codon destroyed probably benign 0.01
R1802:Celf2 UTSW 2 6549933 missense probably damaging 1.00
R1898:Celf2 UTSW 2 6604164 missense probably damaging 1.00
R1912:Celf2 UTSW 2 6615753 missense probably damaging 1.00
R2422:Celf2 UTSW 2 6553889 missense probably damaging 1.00
R2848:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R2849:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R3708:Celf2 UTSW 2 6624678 missense probably damaging 1.00
R4295:Celf2 UTSW 2 6604064 missense probably benign 0.10
R4601:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4602:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4610:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4667:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4668:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4669:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4790:Celf2 UTSW 2 6549903 missense probably damaging 1.00
R5022:Celf2 UTSW 2 6607847 intron probably benign
R5369:Celf2 UTSW 2 7081081 intron probably benign
R5540:Celf2 UTSW 2 6553932 missense probably benign 0.43
R5805:Celf2 UTSW 2 6553787 missense probably damaging 1.00
R5913:Celf2 UTSW 2 7081158 start codon destroyed probably null 0.02
R6330:Celf2 UTSW 2 6884955 missense probably benign 0.05
X0018:Celf2 UTSW 2 6553913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCATAAGCCAGAGACCCTGTG -3'
(R):5'- TCAAGTGCAAGGGTTTAGATGG -3'

Sequencing Primer
(F):5'- TGTGCAGGCTTCCCGACAC -3'
(R):5'- CAAGGGTTTAGATGGGGGCTC -3'
Posted On2015-09-25