Incidental Mutation 'R4611:Sec16a'
ID344681
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission 041822-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4611 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26441805 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 66 (V66A)
Ref Sequence ENSEMBL: ENSMUSP00000088796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect probably benign
Transcript: ENSMUST00000091252
AA Change: V66A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: V66A

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114082
AA Change: V66A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: V66A

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151521
Predicted Effect probably benign
Transcript: ENSMUST00000153996
SMART Domains Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 154 170 N/A INTRINSIC
low complexity region 205 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155252
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,393 R200C probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Apc T C 18: 34,318,565 L2804P probably damaging Het
Apob C A 12: 8,011,331 A3271E probably damaging Het
Asl G T 5: 130,018,316 A147E probably damaging Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bcl11b T C 12: 107,916,530 K509E probably damaging Het
Btnl1 T C 17: 34,379,725 I105T probably damaging Het
Btnl10 A G 11: 58,920,357 T169A probably damaging Het
C8b T C 4: 104,790,644 I278T probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd8b1 T C 6: 71,332,475 V181A probably benign Het
Cdan1 A T 2: 120,730,720 V189D probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cfap52 T C 11: 67,926,421 N549D probably damaging Het
Cmklr1 C T 5: 113,614,869 V24M probably benign Het
Cntnap4 G T 8: 112,773,739 probably null Het
Col27a1 G A 4: 63,293,506 G91R probably damaging Het
Col5a3 A G 9: 20,814,896 probably benign Het
Dcc C T 18: 71,548,998 probably null Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah8 T A 17: 30,684,237 L950H probably damaging Het
Dnajc7 A T 11: 100,590,977 Y228* probably null Het
Doxl2 A T 6: 48,975,156 Q5L probably benign Het
Eno1b T C 18: 48,047,703 V316A probably damaging Het
Exoc4 T C 6: 33,438,405 M404T possibly damaging Het
Fignl1 A T 11: 11,801,268 C596S probably benign Het
Fn1 A C 1: 71,624,178 Y1050* probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gba2 T A 4: 43,568,092 S732C probably damaging Het
Gcnt4 C A 13: 96,946,482 S95R probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gria2 A T 3: 80,692,492 M695K probably damaging Het
Hoxa9 T C 6: 52,225,710 K132R probably damaging Het
Ifi213 T A 1: 173,589,914 T311S possibly damaging Het
Itgb2 T A 10: 77,550,050 N282K probably damaging Het
Kcnh8 A T 17: 52,602,836 Q11L probably benign Het
Klk14 T C 7: 43,694,357 C163R probably damaging Het
Klk1b3 T A 7: 44,201,265 W74R possibly damaging Het
Krtap13-1 G T 16: 88,729,254 C122F possibly damaging Het
Luzp2 T C 7: 55,063,356 probably null Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtor T A 4: 148,486,119 V1211E probably benign Het
Myb T A 10: 21,145,324 D402V probably damaging Het
Ncor2 G A 5: 125,030,859 T1593I probably damaging Het
Ndst3 A G 3: 123,671,549 I258T probably benign Het
Npy6r C A 18: 44,276,401 H296Q probably damaging Het
Olfml2b T A 1: 170,644,947 L9H probably damaging Het
Olfr1364 A T 13: 21,573,574 V294D probably damaging Het
Olfr1442 T A 19: 12,674,954 Y250N probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr1475 C T 19: 13,480,012 C62Y probably damaging Het
Olfr43 A T 11: 74,206,535 V227D possibly damaging Het
Olfr519 A G 7: 108,894,117 C97R probably damaging Het
Olfr727 C A 14: 50,127,073 N165K probably benign Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parg G A 14: 32,274,864 R304Q probably damaging Het
Pdf T G 8: 107,048,535 S22R probably benign Het
Phlpp2 A T 8: 109,876,883 R60S possibly damaging Het
Piwil2 C T 14: 70,402,197 E401K probably benign Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Polr3a T C 14: 24,452,508 probably null Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ptch2 G A 4: 117,110,378 D748N probably benign Het
Rai14 A C 15: 10,592,138 Y224D probably damaging Het
Rft1 A G 14: 30,689,790 I432V probably damaging Het
Rictor C T 15: 6,787,144 A1299V possibly damaging Het
Sall2 A G 14: 52,313,753 C662R probably damaging Het
Scn4b A G 9: 45,150,439 N208D probably damaging Het
Sdhb G A 4: 140,972,915 G109R probably damaging Het
Sema4g A G 19: 45,001,612 Y710C probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Shc4 T A 2: 125,655,682 D369V probably benign Het
Siglech T C 7: 55,771,693 L285P probably damaging Het
Skint6 A G 4: 113,074,076 M506T probably benign Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Slfn14 T A 11: 83,283,314 K284* probably null Het
Sox14 A G 9: 99,875,662 I8T probably damaging Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Tdpoz3 A T 3: 93,827,023 H335L probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tnik T C 3: 28,542,100 probably null Het
Tnpo2 T C 8: 85,053,803 S720P probably benign Het
Tpst1 A G 5: 130,101,706 K6E probably damaging Het
Trank1 T A 9: 111,362,261 I446N probably damaging Het
Trmt44 A T 5: 35,575,007 D13E probably benign Het
Ubr4 T A 4: 139,399,579 V471E possibly damaging Het
Ubtd1 A G 19: 42,033,591 T101A probably benign Het
Ugt3a1 A T 15: 9,306,400 K212* probably null Het
Zbtb7c C T 18: 76,136,847 A2V possibly damaging Het
Zfp423 C T 8: 87,688,081 G1182D possibly damaging Het
Zfp618 G A 4: 63,132,979 V666M probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Zscan20 T C 4: 128,588,106 T588A probably benign Het
Zscan25 G A 5: 145,291,116 R530H probably damaging Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAGACTGGCATCTGCTCTAGG -3'
(R):5'- TAAGCAGCATCTCCTTGTGG -3'

Sequencing Primer
(F):5'- CTAGGCTGTGACAGAGTTCCTGAC -3'
(R):5'- GCATCTCCTTGTGGAAAAGACTC -3'
Posted On2015-09-25