Incidental Mutation 'R4611:Mbtps1'
ID344730
Institutional Source Beutler Lab
Gene Symbol Mbtps1
Ensembl Gene ENSMUSG00000031835
Gene Namemembrane-bound transcription factor peptidase, site 1
Synonymssubtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik
MMRRC Submission 041822-MU
Accession Numbers

ENSMUST00000098362; MGI: 1927235

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4611 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location119508156-119558735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119535347 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 354 (D354E)
Ref Sequence ENSEMBL: ENSMUSP00000095965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081381] [ENSMUST00000098362]
Predicted Effect probably damaging
Transcript: ENSMUST00000081381
AA Change: D354E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080117
Gene: ENSMUSG00000031835
AA Change: D354E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 209 464 1.5e-43 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098362
AA Change: D354E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095965
Gene: ENSMUSG00000031835
AA Change: D354E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 213 473 3.7e-45 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212685
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(3) Gene trapped(34) Chemically induced(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,393 R200C probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Apc T C 18: 34,318,565 L2804P probably damaging Het
Apob C A 12: 8,011,331 A3271E probably damaging Het
Asl G T 5: 130,018,316 A147E probably damaging Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bcl11b T C 12: 107,916,530 K509E probably damaging Het
Btnl1 T C 17: 34,379,725 I105T probably damaging Het
Btnl10 A G 11: 58,920,357 T169A probably damaging Het
C8b T C 4: 104,790,644 I278T probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd8b1 T C 6: 71,332,475 V181A probably benign Het
Cdan1 A T 2: 120,730,720 V189D probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cfap52 T C 11: 67,926,421 N549D probably damaging Het
Cmklr1 C T 5: 113,614,869 V24M probably benign Het
Cntnap4 G T 8: 112,773,739 probably null Het
Col27a1 G A 4: 63,293,506 G91R probably damaging Het
Col5a3 A G 9: 20,814,896 probably benign Het
Dcc C T 18: 71,548,998 probably null Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah8 T A 17: 30,684,237 L950H probably damaging Het
Dnajc7 A T 11: 100,590,977 Y228* probably null Het
Doxl2 A T 6: 48,975,156 Q5L probably benign Het
Eno1b T C 18: 48,047,703 V316A probably damaging Het
Exoc4 T C 6: 33,438,405 M404T possibly damaging Het
Fignl1 A T 11: 11,801,268 C596S probably benign Het
Fn1 A C 1: 71,624,178 Y1050* probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gba2 T A 4: 43,568,092 S732C probably damaging Het
Gcnt4 C A 13: 96,946,482 S95R probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gria2 A T 3: 80,692,492 M695K probably damaging Het
Hoxa9 T C 6: 52,225,710 K132R probably damaging Het
Ifi213 T A 1: 173,589,914 T311S possibly damaging Het
Itgb2 T A 10: 77,550,050 N282K probably damaging Het
Kcnh8 A T 17: 52,602,836 Q11L probably benign Het
Klk14 T C 7: 43,694,357 C163R probably damaging Het
Klk1b3 T A 7: 44,201,265 W74R possibly damaging Het
Krtap13-1 G T 16: 88,729,254 C122F possibly damaging Het
Luzp2 T C 7: 55,063,356 probably null Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtor T A 4: 148,486,119 V1211E probably benign Het
Myb T A 10: 21,145,324 D402V probably damaging Het
Ncor2 G A 5: 125,030,859 T1593I probably damaging Het
Ndst3 A G 3: 123,671,549 I258T probably benign Het
Npy6r C A 18: 44,276,401 H296Q probably damaging Het
Olfml2b T A 1: 170,644,947 L9H probably damaging Het
Olfr1364 A T 13: 21,573,574 V294D probably damaging Het
Olfr1442 T A 19: 12,674,954 Y250N probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr1475 C T 19: 13,480,012 C62Y probably damaging Het
Olfr43 A T 11: 74,206,535 V227D possibly damaging Het
Olfr519 A G 7: 108,894,117 C97R probably damaging Het
Olfr727 C A 14: 50,127,073 N165K probably benign Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parg G A 14: 32,274,864 R304Q probably damaging Het
Pdf T G 8: 107,048,535 S22R probably benign Het
Phlpp2 A T 8: 109,876,883 R60S possibly damaging Het
Piwil2 C T 14: 70,402,197 E401K probably benign Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Polr3a T C 14: 24,452,508 probably null Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ptch2 G A 4: 117,110,378 D748N probably benign Het
Rai14 A C 15: 10,592,138 Y224D probably damaging Het
Rft1 A G 14: 30,689,790 I432V probably damaging Het
Rictor C T 15: 6,787,144 A1299V possibly damaging Het
Sall2 A G 14: 52,313,753 C662R probably damaging Het
Scn4b A G 9: 45,150,439 N208D probably damaging Het
Sdhb G A 4: 140,972,915 G109R probably damaging Het
Sec16a A G 2: 26,441,805 V66A probably benign Het
Sema4g A G 19: 45,001,612 Y710C probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Shc4 T A 2: 125,655,682 D369V probably benign Het
Siglech T C 7: 55,771,693 L285P probably damaging Het
Skint6 A G 4: 113,074,076 M506T probably benign Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Slfn14 T A 11: 83,283,314 K284* probably null Het
Sox14 A G 9: 99,875,662 I8T probably damaging Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Tdpoz3 A T 3: 93,827,023 H335L probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tnik T C 3: 28,542,100 probably null Het
Tnpo2 T C 8: 85,053,803 S720P probably benign Het
Tpst1 A G 5: 130,101,706 K6E probably damaging Het
Trank1 T A 9: 111,362,261 I446N probably damaging Het
Trmt44 A T 5: 35,575,007 D13E probably benign Het
Ubr4 T A 4: 139,399,579 V471E possibly damaging Het
Ubtd1 A G 19: 42,033,591 T101A probably benign Het
Ugt3a1 A T 15: 9,306,400 K212* probably null Het
Zbtb7c C T 18: 76,136,847 A2V possibly damaging Het
Zfp423 C T 8: 87,688,081 G1182D possibly damaging Het
Zfp618 G A 4: 63,132,979 V666M probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Zscan20 T C 4: 128,588,106 T588A probably benign Het
Zscan25 G A 5: 145,291,116 R530H probably damaging Het
Other mutations in Mbtps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
muskrat UTSW 8 119538137 missense probably damaging 1.00
packrat UTSW 8 119528961 missense probably damaging 1.00
woodrat UTSW 8 119529030 missense probably damaging 1.00
R0194:Mbtps1 UTSW 8 119535369 missense probably damaging 1.00
R0270:Mbtps1 UTSW 8 119538117 splice site probably benign
R0485:Mbtps1 UTSW 8 119522601 splice site probably benign
R1269:Mbtps1 UTSW 8 119520277 missense probably damaging 1.00
R1351:Mbtps1 UTSW 8 119518162 missense possibly damaging 0.95
R1536:Mbtps1 UTSW 8 119546125 missense probably benign 0.01
R1542:Mbtps1 UTSW 8 119546247 splice site probably null
R1543:Mbtps1 UTSW 8 119542069 splice site probably benign
R1580:Mbtps1 UTSW 8 119538900 missense possibly damaging 0.79
R1587:Mbtps1 UTSW 8 119518219 missense probably damaging 0.96
R1715:Mbtps1 UTSW 8 119542730 missense probably benign 0.40
R1845:Mbtps1 UTSW 8 119522493 missense probably benign 0.13
R2147:Mbtps1 UTSW 8 119538859 missense probably benign 0.01
R2157:Mbtps1 UTSW 8 119542727 missense probably benign 0.01
R2416:Mbtps1 UTSW 8 119538917 missense probably damaging 1.00
R2910:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R2911:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R3079:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3079:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R3080:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3080:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R4116:Mbtps1 UTSW 8 119541652 missense probably benign 0.00
R4296:Mbtps1 UTSW 8 119522499 missense possibly damaging 0.95
R4602:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4603:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4610:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4729:Mbtps1 UTSW 8 119525420 missense probably damaging 1.00
R4868:Mbtps1 UTSW 8 119508928 missense probably benign 0.01
R4893:Mbtps1 UTSW 8 119518193 missense probably damaging 1.00
R4999:Mbtps1 UTSW 8 119533348 missense probably damaging 1.00
R6056:Mbtps1 UTSW 8 119515602 missense probably benign
R6062:Mbtps1 UTSW 8 119531091 missense possibly damaging 0.94
R6237:Mbtps1 UTSW 8 119528961 missense probably damaging 1.00
R6617:Mbtps1 UTSW 8 119538137 missense probably damaging 1.00
R7215:Mbtps1 UTSW 8 119524568 missense possibly damaging 0.82
R7275:Mbtps1 UTSW 8 119542750 missense probably benign
X0017:Mbtps1 UTSW 8 119531124 missense probably damaging 1.00
X0027:Mbtps1 UTSW 8 119522547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAAAGTTCCTGATCCCTTG -3'
(R):5'- TGCGCACTTTCGGACAGAAG -3'

Sequencing Primer
(F):5'- TGTGTGTACATACCCACAGC -3'
(R):5'- CTTTCGGACAGAAGACAGAAATGACC -3'
Posted On2015-09-25