Incidental Mutation 'R4611:Apc'
ID344774
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Nameadenomatosis polyposis coli
SynonymsCC1, Min
MMRRC Submission 041822-MU
Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Is this an essential gene? Probably essential (E-score: 0.990) question?
Stock #R4611 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34220924-34322189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34318565 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2804 (L2804P)
Ref Sequence ENSEMBL: ENSMUSP00000111447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781]
Predicted Effect probably damaging
Transcript: ENSMUST00000079362
AA Change: L2838P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: L2838P

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115781
AA Change: L2804P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: L2804P

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165590
SMART Domains Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:3AU3|A 2 33 2e-17 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,393 R200C probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Apob C A 12: 8,011,331 A3271E probably damaging Het
Asl G T 5: 130,018,316 A147E probably damaging Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bcl11b T C 12: 107,916,530 K509E probably damaging Het
Btnl1 T C 17: 34,379,725 I105T probably damaging Het
Btnl10 A G 11: 58,920,357 T169A probably damaging Het
C8b T C 4: 104,790,644 I278T probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd8b1 T C 6: 71,332,475 V181A probably benign Het
Cdan1 A T 2: 120,730,720 V189D probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cfap52 T C 11: 67,926,421 N549D probably damaging Het
Cmklr1 C T 5: 113,614,869 V24M probably benign Het
Cntnap4 G T 8: 112,773,739 probably null Het
Col27a1 G A 4: 63,293,506 G91R probably damaging Het
Col5a3 A G 9: 20,814,896 probably benign Het
Dcc C T 18: 71,548,998 probably null Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah8 T A 17: 30,684,237 L950H probably damaging Het
Dnajc7 A T 11: 100,590,977 Y228* probably null Het
Doxl2 A T 6: 48,975,156 Q5L probably benign Het
Eno1b T C 18: 48,047,703 V316A probably damaging Het
Exoc4 T C 6: 33,438,405 M404T possibly damaging Het
Fignl1 A T 11: 11,801,268 C596S probably benign Het
Fn1 A C 1: 71,624,178 Y1050* probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gba2 T A 4: 43,568,092 S732C probably damaging Het
Gcnt4 C A 13: 96,946,482 S95R probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gria2 A T 3: 80,692,492 M695K probably damaging Het
Hoxa9 T C 6: 52,225,710 K132R probably damaging Het
Ifi213 T A 1: 173,589,914 T311S possibly damaging Het
Itgb2 T A 10: 77,550,050 N282K probably damaging Het
Kcnh8 A T 17: 52,602,836 Q11L probably benign Het
Klk14 T C 7: 43,694,357 C163R probably damaging Het
Klk1b3 T A 7: 44,201,265 W74R possibly damaging Het
Krtap13-1 G T 16: 88,729,254 C122F possibly damaging Het
Luzp2 T C 7: 55,063,356 probably null Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtor T A 4: 148,486,119 V1211E probably benign Het
Myb T A 10: 21,145,324 D402V probably damaging Het
Ncor2 G A 5: 125,030,859 T1593I probably damaging Het
Ndst3 A G 3: 123,671,549 I258T probably benign Het
Npy6r C A 18: 44,276,401 H296Q probably damaging Het
Olfml2b T A 1: 170,644,947 L9H probably damaging Het
Olfr1364 A T 13: 21,573,574 V294D probably damaging Het
Olfr1442 T A 19: 12,674,954 Y250N probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr1475 C T 19: 13,480,012 C62Y probably damaging Het
Olfr43 A T 11: 74,206,535 V227D possibly damaging Het
Olfr519 A G 7: 108,894,117 C97R probably damaging Het
Olfr727 C A 14: 50,127,073 N165K probably benign Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parg G A 14: 32,274,864 R304Q probably damaging Het
Pdf T G 8: 107,048,535 S22R probably benign Het
Phlpp2 A T 8: 109,876,883 R60S possibly damaging Het
Piwil2 C T 14: 70,402,197 E401K probably benign Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Polr3a T C 14: 24,452,508 probably null Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ptch2 G A 4: 117,110,378 D748N probably benign Het
Rai14 A C 15: 10,592,138 Y224D probably damaging Het
Rft1 A G 14: 30,689,790 I432V probably damaging Het
Rictor C T 15: 6,787,144 A1299V possibly damaging Het
Sall2 A G 14: 52,313,753 C662R probably damaging Het
Scn4b A G 9: 45,150,439 N208D probably damaging Het
Sdhb G A 4: 140,972,915 G109R probably damaging Het
Sec16a A G 2: 26,441,805 V66A probably benign Het
Sema4g A G 19: 45,001,612 Y710C probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Shc4 T A 2: 125,655,682 D369V probably benign Het
Siglech T C 7: 55,771,693 L285P probably damaging Het
Skint6 A G 4: 113,074,076 M506T probably benign Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Slfn14 T A 11: 83,283,314 K284* probably null Het
Sox14 A G 9: 99,875,662 I8T probably damaging Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Tdpoz3 A T 3: 93,827,023 H335L probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tnik T C 3: 28,542,100 probably null Het
Tnpo2 T C 8: 85,053,803 S720P probably benign Het
Tpst1 A G 5: 130,101,706 K6E probably damaging Het
Trank1 T A 9: 111,362,261 I446N probably damaging Het
Trmt44 A T 5: 35,575,007 D13E probably benign Het
Ubr4 T A 4: 139,399,579 V471E possibly damaging Het
Ubtd1 A G 19: 42,033,591 T101A probably benign Het
Ugt3a1 A T 15: 9,306,400 K212* probably null Het
Zbtb7c C T 18: 76,136,847 A2V possibly damaging Het
Zfp423 C T 8: 87,688,081 G1182D possibly damaging Het
Zfp618 G A 4: 63,132,979 V666M probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Zscan20 T C 4: 128,588,106 T588A probably benign Het
Zscan25 G A 5: 145,291,116 R530H probably damaging Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34316926 missense probably benign 0.01
IGL00898:Apc APN 18 34317094 missense probably damaging 1.00
IGL01111:Apc APN 18 34315136 missense possibly damaging 0.95
IGL01347:Apc APN 18 34317670 missense probably damaging 1.00
IGL01375:Apc APN 18 34313654 missense probably damaging 1.00
IGL01805:Apc APN 18 34318218 missense probably benign 0.02
IGL01997:Apc APN 18 34315423 missense probably benign 0.00
IGL02033:Apc APN 18 34310719 missense probably damaging 1.00
IGL02323:Apc APN 18 34315810 nonsense probably null
IGL02373:Apc APN 18 34316159 missense probably damaging 1.00
IGL02379:Apc APN 18 34298745 missense probably benign 0.45
IGL02456:Apc APN 18 34313882 nonsense probably null
IGL02552:Apc APN 18 34312982 missense possibly damaging 0.90
IGL02676:Apc APN 18 34315634 missense probably damaging 1.00
IGL02756:Apc APN 18 34314535 missense probably damaging 1.00
IGL02938:Apc APN 18 34315228 missense probably damaging 0.98
IGL02974:Apc APN 18 34268383 splice site probably benign
IGL03124:Apc APN 18 34299985 missense probably damaging 0.98
IGL03201:Apc APN 18 34312376 missense probably damaging 1.00
IGL03339:Apc APN 18 34298474 missense probably damaging 1.00
FR4304:Apc UTSW 18 34281997 intron probably benign
FR4342:Apc UTSW 18 34281999 intron probably benign
FR4449:Apc UTSW 18 34282000 intron probably benign
FR4449:Apc UTSW 18 34282005 intron probably benign
FR4548:Apc UTSW 18 34281998 intron probably benign
FR4737:Apc UTSW 18 34281999 intron probably benign
FR4976:Apc UTSW 18 34281998 intron probably benign
FR4976:Apc UTSW 18 34282000 intron probably benign
FR4976:Apc UTSW 18 34282004 nonsense probably null
R0385:Apc UTSW 18 34315944 missense probably damaging 1.00
R0535:Apc UTSW 18 34261072 missense probably damaging 1.00
R0561:Apc UTSW 18 34313303 missense possibly damaging 0.94
R0590:Apc UTSW 18 34316230 nonsense probably null
R0626:Apc UTSW 18 34318454 missense probably damaging 1.00
R0991:Apc UTSW 18 34316107 missense probably damaging 1.00
R1564:Apc UTSW 18 34315149 missense probably benign 0.00
R1663:Apc UTSW 18 34268325 missense probably damaging 0.98
R1737:Apc UTSW 18 34317022 missense probably damaging 1.00
R1739:Apc UTSW 18 34312318 missense probably damaging 1.00
R1835:Apc UTSW 18 34317077 missense probably damaging 1.00
R1887:Apc UTSW 18 34272468 missense probably damaging 1.00
R1957:Apc UTSW 18 34317335 missense probably damaging 1.00
R1974:Apc UTSW 18 34300004 missense possibly damaging 0.62
R2005:Apc UTSW 18 34310909 critical splice donor site probably null
R2013:Apc UTSW 18 34315591 missense probably damaging 0.98
R2014:Apc UTSW 18 34315591 missense probably damaging 0.98
R2015:Apc UTSW 18 34315591 missense probably damaging 0.98
R2017:Apc UTSW 18 34313602 missense probably benign 0.00
R2056:Apc UTSW 18 34316428 missense probably damaging 1.00
R2108:Apc UTSW 18 34269229 missense probably damaging 1.00
R2120:Apc UTSW 18 34276601 missense probably damaging 1.00
R2131:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2133:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2291:Apc UTSW 18 34312491 missense probably benign 0.45
R2332:Apc UTSW 18 34317059 missense possibly damaging 0.50
R2360:Apc UTSW 18 34261126 missense probably damaging 1.00
R2407:Apc UTSW 18 34314262 missense possibly damaging 0.77
R2507:Apc UTSW 18 34316537 missense possibly damaging 0.77
R2940:Apc UTSW 18 34276670 missense probably damaging 1.00
R3404:Apc UTSW 18 34313602 missense probably benign 0.00
R3411:Apc UTSW 18 34269259 splice site probably benign
R3778:Apc UTSW 18 34313081 missense probably damaging 1.00
R3826:Apc UTSW 18 34279335 missense possibly damaging 0.93
R4599:Apc UTSW 18 34317987 nonsense probably null
R4664:Apc UTSW 18 34298594 missense probably damaging 0.98
R4969:Apc UTSW 18 34312918 nonsense probably null
R5007:Apc UTSW 18 34312963 missense probably damaging 1.00
R5066:Apc UTSW 18 34316105 missense probably damaging 1.00
R5112:Apc UTSW 18 34316109 nonsense probably null
R5259:Apc UTSW 18 34314290 missense probably benign 0.29
R5440:Apc UTSW 18 34221160 unclassified probably benign
R5508:Apc UTSW 18 34298580 missense probably damaging 0.97
R5512:Apc UTSW 18 34310909 critical splice donor site probably benign
R5850:Apc UTSW 18 34318063 missense possibly damaging 0.94
R5951:Apc UTSW 18 34317146 missense possibly damaging 0.89
R5966:Apc UTSW 18 34221087 utr 5 prime probably benign
R6081:Apc UTSW 18 34290111 missense possibly damaging 0.93
R6116:Apc UTSW 18 34316455 missense probably damaging 1.00
R6351:Apc UTSW 18 34312212 missense probably damaging 1.00
R6354:Apc UTSW 18 34312528 missense probably benign 0.02
R6467:Apc UTSW 18 34269199 missense probably benign 0.22
R6974:Apc UTSW 18 34298427 missense possibly damaging 0.65
X0021:Apc UTSW 18 34312108 missense probably damaging 1.00
X0025:Apc UTSW 18 34312376 missense probably damaging 1.00
Z1088:Apc UTSW 18 34313167 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTAGCTCCAGCAAGCACAG -3'
(R):5'- GTGCCTCCCAAAATGACCAG -3'

Sequencing Primer
(F):5'- ACTGTTGCTGCCAGAGTGAC -3'
(R):5'- TCCCAAAATGACCAGTGAGG -3'
Posted On2015-09-25