Incidental Mutation 'R4612:Zfhx4'
ID344796
Institutional Source Beutler Lab
Gene Symbol Zfhx4
Ensembl Gene ENSMUSG00000025255
Gene Namezinc finger homeodomain 4
SynonymsZfh4, C130041O22Rik, Zfh-4
MMRRC Submission 041823-MU
Accession Numbers

Genbank: NM_030708; MGI: 2137668

Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R4612 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location5218526-5415857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5397063 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 1266 (S1266N)
Ref Sequence ENSEMBL: ENSMUSP00000135827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]
Predicted Effect probably damaging
Transcript: ENSMUST00000026284
AA Change: S1241N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: S1241N

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175866
AA Change: S1266N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: S1266N

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 902 923 2.44e2 SMART
ZnF_U1 938 972 2.88e0 SMART
ZnF_C2H2 941 965 1.23e0 SMART
ZnF_C2H2 997 1019 7.05e-1 SMART
ZnF_U1 1042 1076 3.73e0 SMART
ZnF_C2H2 1045 1069 4.98e-1 SMART
ZnF_C2H2 1213 1236 1.1e-2 SMART
ZnF_C2H2 1242 1265 4.94e0 SMART
ZnF_C2H2 1393 1415 7.67e-2 SMART
ZnF_C2H2 1421 1444 1.33e-1 SMART
ZnF_U1 1534 1568 7.4e-1 SMART
ZnF_C2H2 1537 1561 8.22e-2 SMART
ZnF_U1 1586 1620 3.73e0 SMART
ZnF_C2H2 1589 1613 1.16e-1 SMART
low complexity region 1689 1717 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1787 1833 N/A INTRINSIC
ZnF_C2H2 1941 1964 3.07e-1 SMART
low complexity region 1989 2015 N/A INTRINSIC
low complexity region 2033 2057 N/A INTRINSIC
low complexity region 2080 2097 N/A INTRINSIC
HOX 2125 2187 4.23e-16 SMART
HOX 2222 2284 5.62e-21 SMART
ZnF_C2H2 2308 2328 1.13e1 SMART
low complexity region 2389 2401 N/A INTRINSIC
low complexity region 2433 2450 N/A INTRINSIC
low complexity region 2474 2485 N/A INTRINSIC
ZnF_C2H2 2486 2508 2.17e-1 SMART
HOX 2598 2660 3.18e-20 SMART
ZnF_C2H2 2668 2691 6.67e-2 SMART
low complexity region 2899 2911 N/A INTRINSIC
HOX 2921 2983 4.54e-16 SMART
ZnF_U1 2996 3030 6.59e-1 SMART
ZnF_C2H2 2999 3023 1.36e1 SMART
low complexity region 3091 3103 N/A INTRINSIC
low complexity region 3131 3144 N/A INTRINSIC
low complexity region 3188 3211 N/A INTRINSIC
coiled coil region 3304 3333 N/A INTRINSIC
ZnF_C2H2 3393 3413 1.12e2 SMART
ZnF_U1 3434 3468 6.16e-2 SMART
ZnF_C2H2 3437 3461 6.57e0 SMART
low complexity region 3486 3504 N/A INTRINSIC
low complexity region 3530 3552 N/A INTRINSIC
low complexity region 3561 3572 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176383
AA Change: S1241N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: S1241N

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,476 D31G probably benign Het
5730455P16Rik A T 11: 80,377,980 M1K probably null Het
Abca15 A G 7: 120,335,161 D120G probably benign Het
Adam26a A T 8: 43,568,793 N553K probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adam39 A T 8: 40,825,921 S450C probably damaging Het
Agap2 A T 10: 127,080,096 T159S unknown Het
Ahnak G A 19: 9,003,724 V791I probably benign Het
Ak7 T G 12: 105,761,513 L468R probably damaging Het
Akap12 A G 10: 4,354,456 D422G probably damaging Het
Antxr1 T A 6: 87,288,173 I129F probably damaging Het
Arhgap32 G A 9: 32,259,479 G1185D probably damaging Het
Atf7ip2 A T 16: 10,241,563 E322D probably benign Het
Atg4b T C 1: 93,786,541 F349L probably damaging Het
Atp6v1c1 A G 15: 38,677,612 K127R probably damaging Het
Atxn1l C T 8: 109,732,104 V509M possibly damaging Het
B3glct T A 5: 149,739,557 I260N probably damaging Het
Bcl2l12 G A 7: 44,996,585 P70L probably damaging Het
Bok T A 1: 93,694,178 F157L probably damaging Het
Bves G A 10: 45,339,277 G16D probably benign Het
Cacna1b T A 2: 24,626,852 K65* probably null Het
Casc3 A G 11: 98,822,958 T339A probably benign Het
Ccdc18 C T 5: 108,135,441 S6L probably benign Het
Cd86 A G 16: 36,615,330 Y242H probably benign Het
Chd3 A C 11: 69,353,209 Y1249* probably null Het
Chrne T C 11: 70,617,022 T284A probably damaging Het
Col12a1 T C 9: 79,616,057 D2746G probably damaging Het
Cryaa T A 17: 31,678,474 M72K probably benign Het
Csmd1 G T 8: 15,921,908 probably null Het
Det1 A T 7: 78,843,706 N183K probably damaging Het
Dis3 C A 14: 99,091,435 V294L probably benign Het
Dnah2 G A 11: 69,483,367 L1493F possibly damaging Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dsg4 T A 18: 20,462,413 S558T probably benign Het
Dzip3 A T 16: 48,952,040 L422* probably null Het
Elp6 T C 9: 110,314,019 F100S probably damaging Het
Epg5 C T 18: 77,982,414 T1224I possibly damaging Het
F830016B08Rik T A 18: 60,301,015 I390N probably benign Het
Fam110c A G 12: 31,074,656 T206A unknown Het
Fam160a1 G A 3: 85,730,372 R207* probably null Het
Fam187b G A 7: 30,977,093 G9D possibly damaging Het
Fat1 A G 8: 45,025,147 D2410G probably damaging Het
Fbln1 T A 15: 85,238,559 F390Y probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Flcn T C 11: 59,792,687 T555A probably damaging Het
Foxq1 G T 13: 31,558,825 probably benign Het
Gm3233 A T 10: 77,759,664 probably benign Het
Gm5346 A T 8: 43,626,550 F212L probably benign Het
Gm7271 A T 5: 76,516,498 N145Y probably damaging Het
Gprc5a G A 6: 135,078,929 V125I probably damaging Het
Gria2 T C 3: 80,732,051 D218G probably damaging Het
Gtf3c5 C T 2: 28,579,584 A103T probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Hspg2 A G 4: 137,539,575 T1964A possibly damaging Het
Htatip2 G T 7: 49,772,597 E188* probably null Het
Ifna13 T G 4: 88,643,876 E170D probably damaging Het
Il4ra A G 7: 125,576,083 T488A probably benign Het
Jup G T 11: 100,381,834 H251N probably damaging Het
Kif21a A T 15: 90,968,223 probably null Het
Klhl28 T A 12: 64,957,260 I160L probably damaging Het
Klk5 A T 7: 43,845,272 T60S possibly damaging Het
Kntc1 A G 5: 123,812,643 R1995G probably damaging Het
Lrig2 A C 3: 104,462,783 I844M probably damaging Het
Lrp2 C T 2: 69,458,427 W3698* probably null Het
Lyar T A 5: 38,224,709 S12T possibly damaging Het
Map3k19 T C 1: 127,815,300 K1507E probably benign Het
Mre11a G A 9: 14,802,903 G267R probably damaging Het
Mthfd1l A G 10: 4,030,717 Q473R probably damaging Het
Ncald T A 15: 37,397,349 E29V probably benign Het
Neb T C 2: 52,287,243 D1362G probably damaging Het
Nme2 T C 11: 93,955,602 T7A possibly damaging Het
Nod2 T A 8: 88,665,036 L657Q possibly damaging Het
Nrm T A 17: 35,863,529 V75E probably benign Het
Ogfod1 A C 8: 94,037,347 K20T possibly damaging Het
Olfr197 T C 16: 59,186,311 I57M probably damaging Het
Olfr294 T A 7: 86,615,736 Q303L probably benign Het
Olfr63 T A 17: 33,269,480 V252E probably benign Het
Omp T C 7: 98,145,141 N93S probably damaging Het
Pcdhb15 A C 18: 37,475,595 T627P probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pogk C A 1: 166,398,765 E606* probably null Het
Ppp1r10 T A 17: 35,927,931 L292Q probably damaging Het
Prpf6 T C 2: 181,632,079 C339R possibly damaging Het
Psd T A 19: 46,313,339 D937V probably benign Het
Rbak T C 5: 143,174,467 Q277R probably benign Het
Sbno1 T A 5: 124,404,024 Y355F probably damaging Het
Sec23ip C T 7: 128,750,502 Q201* probably null Het
Serpinb3a T C 1: 107,047,607 K157E probably damaging Het
Slc22a28 A T 19: 8,101,406 N306K probably damaging Het
Smarca2 C A 19: 26,776,225 D1584E possibly damaging Het
Snx29 C A 16: 11,447,495 Q530K probably damaging Het
Stard10 C A 7: 101,345,670 Q278K possibly damaging Het
Tgm2 C T 2: 158,124,204 C510Y probably benign Het
Tlr9 C T 9: 106,223,807 P99L probably damaging Het
Tmco4 T C 4: 138,990,560 W4R probably benign Het
Tmem151a T A 19: 5,071,834 probably benign Het
Tmem255b T C 8: 13,454,228 V140A probably benign Het
Trbj1-2 C T 6: 41,534,016 probably benign Het
Trpm2 T C 10: 77,945,916 T290A probably damaging Het
Tsc22d1 G A 14: 76,419,005 E120K possibly damaging Het
Ttc29 A G 8: 78,325,546 D352G probably benign Het
Usp25 A T 16: 77,033,945 I30F possibly damaging Het
Usp34 A C 11: 23,432,268 N1993T probably damaging Het
Vmn2r124 A C 17: 18,063,022 H326P probably benign Het
Vmn2r92 C A 17: 18,166,870 T157K probably benign Het
Vstm5 A T 9: 15,257,493 I118F probably benign Het
Vwa7 T C 17: 35,023,450 V510A probably damaging Het
Zfp763 T A 17: 33,018,948 N408Y probably benign Het
Zswim5 C T 4: 116,986,704 H980Y probably damaging Het
Other mutations in Zfhx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfhx4 APN 3 5242341 missense probably damaging 1.00
IGL00915:Zfhx4 APN 3 5245523 missense probably damaging 0.99
IGL01145:Zfhx4 APN 3 5245347 missense probably damaging 1.00
IGL01302:Zfhx4 APN 3 5243568 missense probably damaging 1.00
IGL01314:Zfhx4 APN 3 5413094 missense probably damaging 0.98
IGL01321:Zfhx4 APN 3 5242328 missense probably benign 0.01
IGL01328:Zfhx4 APN 3 5244284 missense probably damaging 1.00
IGL01333:Zfhx4 APN 3 5399327 missense probably damaging 1.00
IGL01351:Zfhx4 APN 3 5401136 missense probably damaging 1.00
IGL01524:Zfhx4 APN 3 5243976 missense probably damaging 1.00
IGL01549:Zfhx4 APN 3 5399462 missense probably damaging 1.00
IGL01715:Zfhx4 APN 3 5242045 missense probably benign 0.00
IGL01736:Zfhx4 APN 3 5244092 missense possibly damaging 0.85
IGL01904:Zfhx4 APN 3 5412709 missense probably damaging 1.00
IGL02298:Zfhx4 APN 3 5244304 splice site probably null
IGL02342:Zfhx4 APN 3 5402374 missense probably benign 0.14
IGL02465:Zfhx4 APN 3 5399603 missense possibly damaging 0.48
IGL02481:Zfhx4 APN 3 5411843 missense probably damaging 0.99
IGL02511:Zfhx4 APN 3 5399183 missense probably damaging 1.00
IGL02571:Zfhx4 APN 3 5329523 missense probably damaging 1.00
IGL02685:Zfhx4 APN 3 5412153 missense probably damaging 1.00
IGL02721:Zfhx4 APN 3 5243307 missense possibly damaging 0.76
IGL02806:Zfhx4 APN 3 5390408 missense probably benign 0.00
IGL03140:Zfhx4 APN 3 5242525 missense probably damaging 1.00
IGL03185:Zfhx4 APN 3 5403914 missense probably benign 0.05
IGL03209:Zfhx4 APN 3 5401171 missense probably damaging 1.00
IGL03292:Zfhx4 APN 3 5411780 nonsense probably null
IGL03302:Zfhx4 APN 3 5403713 missense possibly damaging 0.88
IGL03303:Zfhx4 APN 3 5403350 missense probably damaging 1.00
IGL03341:Zfhx4 APN 3 5411850 missense probably damaging 0.98
3-1:Zfhx4 UTSW 3 5403385 missense probably benign 0.14
B5639:Zfhx4 UTSW 3 5403175 missense probably damaging 0.99
IGL02796:Zfhx4 UTSW 3 5399539 missense probably damaging 1.00
IGL03047:Zfhx4 UTSW 3 5243733 missense probably damaging 0.99
P0025:Zfhx4 UTSW 3 5399588 missense probably benign 0.04
R0090:Zfhx4 UTSW 3 5243625 missense probably damaging 1.00
R0107:Zfhx4 UTSW 3 5398982 missense probably damaging 1.00
R0401:Zfhx4 UTSW 3 5401161 missense possibly damaging 0.87
R0465:Zfhx4 UTSW 3 5245656 splice site probably benign
R0506:Zfhx4 UTSW 3 5402735 missense probably damaging 1.00
R0507:Zfhx4 UTSW 3 5400988 nonsense probably null
R0550:Zfhx4 UTSW 3 5400494 missense probably damaging 0.99
R0576:Zfhx4 UTSW 3 5402101 missense probably damaging 1.00
R0590:Zfhx4 UTSW 3 5402633 missense probably damaging 1.00
R0697:Zfhx4 UTSW 3 5401733 missense probably damaging 0.99
R0727:Zfhx4 UTSW 3 5401073 missense probably damaging 0.98
R0762:Zfhx4 UTSW 3 5403820 missense probably damaging 1.00
R0815:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0863:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0866:Zfhx4 UTSW 3 5412212 missense possibly damaging 0.58
R1109:Zfhx4 UTSW 3 5399870 missense possibly damaging 0.59
R1177:Zfhx4 UTSW 3 5400831 small deletion probably benign
R1338:Zfhx4 UTSW 3 5396961 missense possibly damaging 0.86
R1388:Zfhx4 UTSW 3 5401387 missense probably damaging 1.00
R1434:Zfhx4 UTSW 3 5241859 missense probably benign 0.00
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1552:Zfhx4 UTSW 3 5403110 missense probably damaging 1.00
R1589:Zfhx4 UTSW 3 5241729 missense probably damaging 1.00
R1633:Zfhx4 UTSW 3 5400413 missense probably damaging 1.00
R1656:Zfhx4 UTSW 3 5413016 missense probably damaging 1.00
R1717:Zfhx4 UTSW 3 5403104 missense probably benign 0.20
R1739:Zfhx4 UTSW 3 5401730 missense probably damaging 1.00
R1760:Zfhx4 UTSW 3 5382616 missense probably benign
R1842:Zfhx4 UTSW 3 5401498 missense probably damaging 1.00
R1867:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R1868:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R2064:Zfhx4 UTSW 3 5398927 missense probably damaging 1.00
R2083:Zfhx4 UTSW 3 5403163 missense possibly damaging 0.58
R2154:Zfhx4 UTSW 3 5401741 missense possibly damaging 0.86
R2165:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2181:Zfhx4 UTSW 3 5403332 missense probably damaging 1.00
R2201:Zfhx4 UTSW 3 5242289 missense probably damaging 1.00
R2209:Zfhx4 UTSW 3 5396918 missense probably damaging 1.00
R2303:Zfhx4 UTSW 3 5397060 missense probably damaging 0.99
R2327:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2420:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2422:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2516:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2518:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2519:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2520:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2566:Zfhx4 UTSW 3 5245143 missense probably damaging 0.98
R2922:Zfhx4 UTSW 3 5403664 missense probably damaging 1.00
R3000:Zfhx4 UTSW 3 5403654 missense probably damaging 1.00
R3103:Zfhx4 UTSW 3 5399326 missense probably damaging 1.00
R3409:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3414:Zfhx4 UTSW 3 5403823 missense probably damaging 1.00
R3746:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3747:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3748:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3749:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3750:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3763:Zfhx4 UTSW 3 5403344 missense probably damaging 1.00
R3826:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3827:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3830:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3877:Zfhx4 UTSW 3 5400785 missense probably benign
R3919:Zfhx4 UTSW 3 5399115 missense possibly damaging 0.48
R3922:Zfhx4 UTSW 3 5400647 missense probably damaging 1.00
R3927:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3965:Zfhx4 UTSW 3 5403847 missense probably damaging 1.00
R4004:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R4049:Zfhx4 UTSW 3 5398859 missense probably damaging 1.00
R4073:Zfhx4 UTSW 3 5399324 missense probably damaging 1.00
R4134:Zfhx4 UTSW 3 5243627 missense probably damaging 1.00
R4401:Zfhx4 UTSW 3 5403345 nonsense probably null
R4439:Zfhx4 UTSW 3 5214815 unclassified probably benign
R4497:Zfhx4 UTSW 3 5399620 missense possibly damaging 0.88
R4518:Zfhx4 UTSW 3 5412518 missense probably damaging 1.00
R4569:Zfhx4 UTSW 3 5401834 missense probably benign 0.00
R4616:Zfhx4 UTSW 3 5413067 missense possibly damaging 0.66
R4626:Zfhx4 UTSW 3 5402639 missense probably damaging 1.00
R4628:Zfhx4 UTSW 3 5403476 missense probably damaging 1.00
R4637:Zfhx4 UTSW 3 5403404 missense probably damaging 1.00
R4647:Zfhx4 UTSW 3 5399281 missense probably damaging 0.99
R4708:Zfhx4 UTSW 3 5245503 unclassified probably null
R4729:Zfhx4 UTSW 3 5399497 missense probably damaging 1.00
R4732:Zfhx4 UTSW 3 5214807 unclassified probably benign
R4757:Zfhx4 UTSW 3 5400062 missense possibly damaging 0.85
R4765:Zfhx4 UTSW 3 5400152 missense probably benign
R4819:Zfhx4 UTSW 3 5403914 missense probably benign 0.05
R4937:Zfhx4 UTSW 3 5242011 missense probably damaging 1.00
R4980:Zfhx4 UTSW 3 5398979 missense possibly damaging 0.47
R5124:Zfhx4 UTSW 3 5242047 missense probably damaging 1.00
R5214:Zfhx4 UTSW 3 5403641 missense probably damaging 1.00
R5361:Zfhx4 UTSW 3 5399207 missense probably damaging 0.99
R5375:Zfhx4 UTSW 3 5412425 missense probably damaging 0.99
R5485:Zfhx4 UTSW 3 5243007 missense probably damaging 1.00
R5588:Zfhx4 UTSW 3 5403138 missense probably damaging 1.00
R5609:Zfhx4 UTSW 3 5403619 missense probably damaging 1.00
R5726:Zfhx4 UTSW 3 5403321 missense probably benign 0.02
R5758:Zfhx4 UTSW 3 5402620 missense probably damaging 1.00
R5865:Zfhx4 UTSW 3 5402659 missense probably damaging 1.00
R5938:Zfhx4 UTSW 3 5402138 missense probably damaging 0.99
R5952:Zfhx4 UTSW 3 5396970 missense probably damaging 0.99
R6043:Zfhx4 UTSW 3 5403427 missense probably benign 0.00
R6045:Zfhx4 UTSW 3 5396959 missense probably damaging 1.00
R6125:Zfhx4 UTSW 3 5398811 missense possibly damaging 0.68
R6354:Zfhx4 UTSW 3 5401951 missense probably benign
R6374:Zfhx4 UTSW 3 5244035 missense probably damaging 1.00
R6378:Zfhx4 UTSW 3 5243350 missense probably benign 0.07
R6380:Zfhx4 UTSW 3 5413110 missense probably damaging 0.99
R6413:Zfhx4 UTSW 3 5243145 missense probably damaging 1.00
R6449:Zfhx4 UTSW 3 5242428 missense probably damaging 1.00
R6539:Zfhx4 UTSW 3 5244108 missense probably damaging 0.99
R6714:Zfhx4 UTSW 3 5241837 missense probably damaging 1.00
R6933:Zfhx4 UTSW 3 5412987 missense probably damaging 0.99
R6982:Zfhx4 UTSW 3 5403830 missense probably damaging 1.00
R7104:Zfhx4 UTSW 3 5402489 missense not run
R7127:Zfhx4 UTSW 3 5413044 missense not run
R7138:Zfhx4 UTSW 3 5412047 missense not run
X0025:Zfhx4 UTSW 3 5411836 missense probably damaging 0.99
X0026:Zfhx4 UTSW 3 5412338 missense probably benign 0.00
X0028:Zfhx4 UTSW 3 5402414 missense probably benign 0.13
X0028:Zfhx4 UTSW 3 5403267 missense probably damaging 1.00
X0054:Zfhx4 UTSW 3 5399710 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTCAAATTATAGCAGCTGATCATC -3'
(R):5'- GTCCCCACTGTGATTTCTACAG -3'

Sequencing Primer
(F):5'- AGCAGCTGATCATCGTCATG -3'
(R):5'- CACTGTGATTTCTACAGCACAG -3'
Posted On2015-09-25