Incidental Mutation 'R4612:Hspg2'
ID344806
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Nameperlecan (heparan sulfate proteoglycan 2)
SynonymsPlc, Pcn, per
MMRRC Submission 041823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4612 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137468769-137570630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137539575 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1964 (T1964A)
Ref Sequence ENSEMBL: ENSMUSP00000131316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
Predicted Effect probably benign
Transcript: ENSMUST00000030547
AA Change: T1964A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: T1964A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171332
AA Change: T1964A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: T1964A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184284
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,476 D31G probably benign Het
5730455P16Rik A T 11: 80,377,980 M1K probably null Het
Abca15 A G 7: 120,335,161 D120G probably benign Het
Adam26a A T 8: 43,568,793 N553K probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adam39 A T 8: 40,825,921 S450C probably damaging Het
Agap2 A T 10: 127,080,096 T159S unknown Het
Ahnak G A 19: 9,003,724 V791I probably benign Het
Ak7 T G 12: 105,761,513 L468R probably damaging Het
Akap12 A G 10: 4,354,456 D422G probably damaging Het
Antxr1 T A 6: 87,288,173 I129F probably damaging Het
Arhgap32 G A 9: 32,259,479 G1185D probably damaging Het
Atf7ip2 A T 16: 10,241,563 E322D probably benign Het
Atg4b T C 1: 93,786,541 F349L probably damaging Het
Atp6v1c1 A G 15: 38,677,612 K127R probably damaging Het
Atxn1l C T 8: 109,732,104 V509M possibly damaging Het
B3glct T A 5: 149,739,557 I260N probably damaging Het
Bcl2l12 G A 7: 44,996,585 P70L probably damaging Het
Bok T A 1: 93,694,178 F157L probably damaging Het
Bves G A 10: 45,339,277 G16D probably benign Het
Cacna1b T A 2: 24,626,852 K65* probably null Het
Casc3 A G 11: 98,822,958 T339A probably benign Het
Ccdc18 C T 5: 108,135,441 S6L probably benign Het
Cd86 A G 16: 36,615,330 Y242H probably benign Het
Chd3 A C 11: 69,353,209 Y1249* probably null Het
Chrne T C 11: 70,617,022 T284A probably damaging Het
Col12a1 T C 9: 79,616,057 D2746G probably damaging Het
Cryaa T A 17: 31,678,474 M72K probably benign Het
Csmd1 G T 8: 15,921,908 probably null Het
Det1 A T 7: 78,843,706 N183K probably damaging Het
Dis3 C A 14: 99,091,435 V294L probably benign Het
Dnah2 G A 11: 69,483,367 L1493F possibly damaging Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dsg4 T A 18: 20,462,413 S558T probably benign Het
Dzip3 A T 16: 48,952,040 L422* probably null Het
Elp6 T C 9: 110,314,019 F100S probably damaging Het
Epg5 C T 18: 77,982,414 T1224I possibly damaging Het
F830016B08Rik T A 18: 60,301,015 I390N probably benign Het
Fam110c A G 12: 31,074,656 T206A unknown Het
Fam160a1 G A 3: 85,730,372 R207* probably null Het
Fam187b G A 7: 30,977,093 G9D possibly damaging Het
Fat1 A G 8: 45,025,147 D2410G probably damaging Het
Fbln1 T A 15: 85,238,559 F390Y probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Flcn T C 11: 59,792,687 T555A probably damaging Het
Foxq1 G T 13: 31,558,825 probably benign Het
Gm3233 A T 10: 77,759,664 probably benign Het
Gm5346 A T 8: 43,626,550 F212L probably benign Het
Gm7271 A T 5: 76,516,498 N145Y probably damaging Het
Gprc5a G A 6: 135,078,929 V125I probably damaging Het
Gria2 T C 3: 80,732,051 D218G probably damaging Het
Gtf3c5 C T 2: 28,579,584 A103T probably benign Het
Htatip2 G T 7: 49,772,597 E188* probably null Het
Ifna13 T G 4: 88,643,876 E170D probably damaging Het
Il4ra A G 7: 125,576,083 T488A probably benign Het
Jup G T 11: 100,381,834 H251N probably damaging Het
Kif21a A T 15: 90,968,223 probably null Het
Klhl28 T A 12: 64,957,260 I160L probably damaging Het
Klk5 A T 7: 43,845,272 T60S possibly damaging Het
Kntc1 A G 5: 123,812,643 R1995G probably damaging Het
Lrig2 A C 3: 104,462,783 I844M probably damaging Het
Lrp2 C T 2: 69,458,427 W3698* probably null Het
Lyar T A 5: 38,224,709 S12T possibly damaging Het
Map3k19 T C 1: 127,815,300 K1507E probably benign Het
Mre11a G A 9: 14,802,903 G267R probably damaging Het
Mthfd1l A G 10: 4,030,717 Q473R probably damaging Het
Ncald T A 15: 37,397,349 E29V probably benign Het
Neb T C 2: 52,287,243 D1362G probably damaging Het
Nme2 T C 11: 93,955,602 T7A possibly damaging Het
Nod2 T A 8: 88,665,036 L657Q possibly damaging Het
Nrm T A 17: 35,863,529 V75E probably benign Het
Ogfod1 A C 8: 94,037,347 K20T possibly damaging Het
Olfr197 T C 16: 59,186,311 I57M probably damaging Het
Olfr294 T A 7: 86,615,736 Q303L probably benign Het
Olfr63 T A 17: 33,269,480 V252E probably benign Het
Omp T C 7: 98,145,141 N93S probably damaging Het
Pcdhb15 A C 18: 37,475,595 T627P probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pogk C A 1: 166,398,765 E606* probably null Het
Ppp1r10 T A 17: 35,927,931 L292Q probably damaging Het
Prpf6 T C 2: 181,632,079 C339R possibly damaging Het
Psd T A 19: 46,313,339 D937V probably benign Het
Rbak T C 5: 143,174,467 Q277R probably benign Het
Sbno1 T A 5: 124,404,024 Y355F probably damaging Het
Sec23ip C T 7: 128,750,502 Q201* probably null Het
Serpinb3a T C 1: 107,047,607 K157E probably damaging Het
Slc22a28 A T 19: 8,101,406 N306K probably damaging Het
Smarca2 C A 19: 26,776,225 D1584E possibly damaging Het
Snx29 C A 16: 11,447,495 Q530K probably damaging Het
Stard10 C A 7: 101,345,670 Q278K possibly damaging Het
Tgm2 C T 2: 158,124,204 C510Y probably benign Het
Tlr9 C T 9: 106,223,807 P99L probably damaging Het
Tmco4 T C 4: 138,990,560 W4R probably benign Het
Tmem151a T A 19: 5,071,834 probably benign Het
Tmem255b T C 8: 13,454,228 V140A probably benign Het
Trbj1-2 C T 6: 41,534,016 probably benign Het
Trpm2 T C 10: 77,945,916 T290A probably damaging Het
Tsc22d1 G A 14: 76,419,005 E120K possibly damaging Het
Ttc29 A G 8: 78,325,546 D352G probably benign Het
Usp25 A T 16: 77,033,945 I30F possibly damaging Het
Usp34 A C 11: 23,432,268 N1993T probably damaging Het
Vmn2r124 A C 17: 18,063,022 H326P probably benign Het
Vmn2r92 C A 17: 18,166,870 T157K probably benign Het
Vstm5 A T 9: 15,257,493 I118F probably benign Het
Vwa7 T C 17: 35,023,450 V510A probably damaging Het
Zfhx4 G A 3: 5,397,063 S1266N probably damaging Het
Zfp763 T A 17: 33,018,948 N408Y probably benign Het
Zswim5 C T 4: 116,986,704 H980Y probably damaging Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137528820 missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137539195 missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137562201 missense probably benign 0.15
IGL00970:Hspg2 APN 4 137542590 missense probably benign 0.09
IGL01011:Hspg2 APN 4 137559335 missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137546658 missense probably benign 0.11
IGL01333:Hspg2 APN 4 137540314 missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137538489 missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137553817 missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137519706 missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137539183 missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137552803 missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137514773 missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137564926 missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137512671 missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137561926 missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137540073 missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137552254 missense probably benign
IGL02051:Hspg2 APN 4 137568389 unclassified probably benign
IGL02124:Hspg2 APN 4 137518814 splice site probably null
IGL02128:Hspg2 APN 4 137564016 missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137515316 missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137518645 missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137510577 missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137508389 missense probably benign 0.03
IGL02477:Hspg2 APN 4 137544512 splice site probably benign
IGL02514:Hspg2 APN 4 137569576 missense probably benign 0.09
IGL02613:Hspg2 APN 4 137544420 missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137512642 missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137551848 missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137557445 splice site probably benign
IGL02701:Hspg2 APN 4 137557174 missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137555130 missense probably benign 0.00
IGL02985:Hspg2 APN 4 137507803 missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137561825 critical splice donor site probably null
IGL03181:Hspg2 APN 4 137515937 missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137560522 splice site probably benign
PIT4305001:Hspg2 UTSW 4 137550373 missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137519931 missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137542849 missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137562201 missense probably benign 0.15
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137511158 missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137515423 missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137533529 missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137550024 missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137502294 missense probably benign
R0599:Hspg2 UTSW 4 137512401 missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137553280 missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137512349 missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137541440 missense probably benign 0.00
R1403:Hspg2 UTSW 4 137540100 missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137517636 missense probably benign
R1497:Hspg2 UTSW 4 137548096 missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137511241 splice site probably benign
R1625:Hspg2 UTSW 4 137518971 missense probably benign 0.23
R1630:Hspg2 UTSW 4 137518435 missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137533437 nonsense probably null
R1699:Hspg2 UTSW 4 137548012 splice site probably null
R1703:Hspg2 UTSW 4 137559151 missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137514673 missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137520156 missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137518509 missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137545567 missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137565490 missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137542552 missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137564895 missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137568366 missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137559367 missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137520109 missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137517604 missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137522043 missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137549574 missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137555290 missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137565504 splice site probably benign
R3873:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137559314 missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137556657 missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137468911 missense probably benign 0.17
R4355:Hspg2 UTSW 4 137529418 missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4411:Hspg2 UTSW 4 137562224 missense probably benign
R4421:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4592:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4619:Hspg2 UTSW 4 137546573 missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137533730 missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137539645 missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137522127 missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137570073 unclassified probably benign
R4793:Hspg2 UTSW 4 137529473 missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137565395 missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137541666 missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137542530 missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137508031 missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137511926 missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137543914 missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137528794 splice site probably null
R5529:Hspg2 UTSW 4 137551828 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137520551 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137542825 missense probably benign 0.17
R5546:Hspg2 UTSW 4 137548174 critical splice donor site probably null
R5728:Hspg2 UTSW 4 137542766 missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137561721 missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137553782 missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137540735 missense probably benign
R6164:Hspg2 UTSW 4 137514655 missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137569518 missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137540248 missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137519686 missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137544705 missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137561955 missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137541695 missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137539396 missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137507801 missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137555275 missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137565737 missense probably benign 0.18
R6724:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137551803 missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137508398 missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137540720 missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137519289 missense probably benign 0.45
R6968:Hspg2 UTSW 4 137535156 missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137528890 missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137542269 missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137544366 missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137510652 missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137552116 missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137514719 missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137533561 critical splice donor site probably null
R7238:Hspg2 UTSW 4 137508393 missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137519946 missense probably benign 0.15
R7278:Hspg2 UTSW 4 137551125 missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137529556 missense probably benign 0.00
R7390:Hspg2 UTSW 4 137539179 missense probably damaging 1.00
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137550391 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTGAACCCTCGGATCAGGG -3'
(R):5'- TGAGTAGGAGGTTCAGTGAGCC -3'

Sequencing Primer
(F):5'- TCGGATCAGGGCCAGTAC -3'
(R):5'- TCAGTGAGCCCGGGGTTG -3'
Posted On2015-09-25