Incidental Mutation 'R4612:Kntc1'
ID344811
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Namekinetochore associated 1
Synonyms
MMRRC Submission 041823-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4612 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123749716-123821593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123812643 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1995 (R1995G)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
Predicted Effect probably damaging
Transcript: ENSMUST00000031366
AA Change: R1995G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: R1995G

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000197265
AA Change: R53G
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,476 D31G probably benign Het
5730455P16Rik A T 11: 80,377,980 M1K probably null Het
Abca15 A G 7: 120,335,161 D120G probably benign Het
Adam26a A T 8: 43,568,793 N553K probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adam39 A T 8: 40,825,921 S450C probably damaging Het
Agap2 A T 10: 127,080,096 T159S unknown Het
Ahnak G A 19: 9,003,724 V791I probably benign Het
Ak7 T G 12: 105,761,513 L468R probably damaging Het
Akap12 A G 10: 4,354,456 D422G probably damaging Het
Antxr1 T A 6: 87,288,173 I129F probably damaging Het
Arhgap32 G A 9: 32,259,479 G1185D probably damaging Het
Atf7ip2 A T 16: 10,241,563 E322D probably benign Het
Atg4b T C 1: 93,786,541 F349L probably damaging Het
Atp6v1c1 A G 15: 38,677,612 K127R probably damaging Het
Atxn1l C T 8: 109,732,104 V509M possibly damaging Het
B3glct T A 5: 149,739,557 I260N probably damaging Het
Bcl2l12 G A 7: 44,996,585 P70L probably damaging Het
Bok T A 1: 93,694,178 F157L probably damaging Het
Bves G A 10: 45,339,277 G16D probably benign Het
Cacna1b T A 2: 24,626,852 K65* probably null Het
Casc3 A G 11: 98,822,958 T339A probably benign Het
Ccdc18 C T 5: 108,135,441 S6L probably benign Het
Cd86 A G 16: 36,615,330 Y242H probably benign Het
Chd3 A C 11: 69,353,209 Y1249* probably null Het
Chrne T C 11: 70,617,022 T284A probably damaging Het
Col12a1 T C 9: 79,616,057 D2746G probably damaging Het
Cryaa T A 17: 31,678,474 M72K probably benign Het
Csmd1 G T 8: 15,921,908 probably null Het
Det1 A T 7: 78,843,706 N183K probably damaging Het
Dis3 C A 14: 99,091,435 V294L probably benign Het
Dnah2 G A 11: 69,483,367 L1493F possibly damaging Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dsg4 T A 18: 20,462,413 S558T probably benign Het
Dzip3 A T 16: 48,952,040 L422* probably null Het
Elp6 T C 9: 110,314,019 F100S probably damaging Het
Epg5 C T 18: 77,982,414 T1224I possibly damaging Het
F830016B08Rik T A 18: 60,301,015 I390N probably benign Het
Fam110c A G 12: 31,074,656 T206A unknown Het
Fam160a1 G A 3: 85,730,372 R207* probably null Het
Fam187b G A 7: 30,977,093 G9D possibly damaging Het
Fat1 A G 8: 45,025,147 D2410G probably damaging Het
Fbln1 T A 15: 85,238,559 F390Y probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Flcn T C 11: 59,792,687 T555A probably damaging Het
Foxq1 G T 13: 31,558,825 probably benign Het
Gm3233 A T 10: 77,759,664 probably benign Het
Gm5346 A T 8: 43,626,550 F212L probably benign Het
Gm7271 A T 5: 76,516,498 N145Y probably damaging Het
Gprc5a G A 6: 135,078,929 V125I probably damaging Het
Gria2 T C 3: 80,732,051 D218G probably damaging Het
Gtf3c5 C T 2: 28,579,584 A103T probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Hspg2 A G 4: 137,539,575 T1964A possibly damaging Het
Htatip2 G T 7: 49,772,597 E188* probably null Het
Ifna13 T G 4: 88,643,876 E170D probably damaging Het
Il4ra A G 7: 125,576,083 T488A probably benign Het
Jup G T 11: 100,381,834 H251N probably damaging Het
Kif21a A T 15: 90,968,223 probably null Het
Klhl28 T A 12: 64,957,260 I160L probably damaging Het
Klk5 A T 7: 43,845,272 T60S possibly damaging Het
Lrig2 A C 3: 104,462,783 I844M probably damaging Het
Lrp2 C T 2: 69,458,427 W3698* probably null Het
Lyar T A 5: 38,224,709 S12T possibly damaging Het
Map3k19 T C 1: 127,815,300 K1507E probably benign Het
Mre11a G A 9: 14,802,903 G267R probably damaging Het
Mthfd1l A G 10: 4,030,717 Q473R probably damaging Het
Ncald T A 15: 37,397,349 E29V probably benign Het
Neb T C 2: 52,287,243 D1362G probably damaging Het
Nme2 T C 11: 93,955,602 T7A possibly damaging Het
Nod2 T A 8: 88,665,036 L657Q possibly damaging Het
Nrm T A 17: 35,863,529 V75E probably benign Het
Ogfod1 A C 8: 94,037,347 K20T possibly damaging Het
Olfr197 T C 16: 59,186,311 I57M probably damaging Het
Olfr294 T A 7: 86,615,736 Q303L probably benign Het
Olfr63 T A 17: 33,269,480 V252E probably benign Het
Omp T C 7: 98,145,141 N93S probably damaging Het
Pcdhb15 A C 18: 37,475,595 T627P probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pogk C A 1: 166,398,765 E606* probably null Het
Ppp1r10 T A 17: 35,927,931 L292Q probably damaging Het
Prpf6 T C 2: 181,632,079 C339R possibly damaging Het
Psd T A 19: 46,313,339 D937V probably benign Het
Rbak T C 5: 143,174,467 Q277R probably benign Het
Sbno1 T A 5: 124,404,024 Y355F probably damaging Het
Sec23ip C T 7: 128,750,502 Q201* probably null Het
Serpinb3a T C 1: 107,047,607 K157E probably damaging Het
Slc22a28 A T 19: 8,101,406 N306K probably damaging Het
Smarca2 C A 19: 26,776,225 D1584E possibly damaging Het
Snx29 C A 16: 11,447,495 Q530K probably damaging Het
Stard10 C A 7: 101,345,670 Q278K possibly damaging Het
Tgm2 C T 2: 158,124,204 C510Y probably benign Het
Tlr9 C T 9: 106,223,807 P99L probably damaging Het
Tmco4 T C 4: 138,990,560 W4R probably benign Het
Tmem151a T A 19: 5,071,834 probably benign Het
Tmem255b T C 8: 13,454,228 V140A probably benign Het
Trbj1-2 C T 6: 41,534,016 probably benign Het
Trpm2 T C 10: 77,945,916 T290A probably damaging Het
Tsc22d1 G A 14: 76,419,005 E120K possibly damaging Het
Ttc29 A G 8: 78,325,546 D352G probably benign Het
Usp25 A T 16: 77,033,945 I30F possibly damaging Het
Usp34 A C 11: 23,432,268 N1993T probably damaging Het
Vmn2r124 A C 17: 18,063,022 H326P probably benign Het
Vmn2r92 C A 17: 18,166,870 T157K probably benign Het
Vstm5 A T 9: 15,257,493 I118F probably benign Het
Vwa7 T C 17: 35,023,450 V510A probably damaging Het
Zfhx4 G A 3: 5,397,063 S1266N probably damaging Het
Zfp763 T A 17: 33,018,948 N408Y probably benign Het
Zswim5 C T 4: 116,986,704 H980Y probably damaging Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123790159 missense probably benign 0.05
IGL00514:Kntc1 APN 5 123791527 missense probably benign 0.00
IGL01103:Kntc1 APN 5 123764220 missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123762603 missense probably benign 0.01
IGL01357:Kntc1 APN 5 123757814 missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123758483 missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123781658 missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123765005 missense probably benign 0.02
IGL01595:Kntc1 APN 5 123803695 missense probably benign 0.30
IGL01725:Kntc1 APN 5 123764190 missense probably benign
IGL01916:Kntc1 APN 5 123801913 missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123811376 missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123778267 missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123765958 missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123809096 missense probably benign 0.12
IGL02145:Kntc1 APN 5 123762598 missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123819062 missense probably benign 0.03
IGL02611:Kntc1 APN 5 123812065 missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123755664 splice site probably benign
IGL02737:Kntc1 APN 5 123819120 missense probably benign 0.17
IGL02793:Kntc1 APN 5 123778277 unclassified probably null
IGL02809:Kntc1 APN 5 123776582 missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123769873 missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123778277 unclassified probably null
IGL02931:Kntc1 APN 5 123799811 missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123775821 missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123758480 missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0017:Kntc1 UTSW 5 123780981 missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123765057 splice site probably benign
R0324:Kntc1 UTSW 5 123778112 missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123803669 missense probably benign 0.00
R0608:Kntc1 UTSW 5 123786074 missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123769704 missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123790916 missense probably null
R0781:Kntc1 UTSW 5 123799902 splice site probably benign
R0787:Kntc1 UTSW 5 123796104 missense probably benign
R1250:Kntc1 UTSW 5 123784199 missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123810862 frame shift probably null
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1481:Kntc1 UTSW 5 123778275 missense probably benign 0.00
R1572:Kntc1 UTSW 5 123772113 missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123758477 missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123789099 missense probably benign 0.00
R1993:Kntc1 UTSW 5 123759099 critical splice donor site probably null
R1993:Kntc1 UTSW 5 123810811 critical splice acceptor site probably null
R2071:Kntc1 UTSW 5 123794277 splice site probably null
R2237:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123760348 missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123764149 missense probably benign 0.01
R2442:Kntc1 UTSW 5 123810859 missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123778347 nonsense probably null
R2943:Kntc1 UTSW 5 123797784 missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123802058 missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123762598 missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123776617 missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123767779 missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123794153 missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123811433 missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123765023 missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123790133 nonsense probably null
R4847:Kntc1 UTSW 5 123802274 missense probably benign 0.18
R4849:Kntc1 UTSW 5 123759065 missense probably benign 0.02
R4904:Kntc1 UTSW 5 123778333 missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123802246 missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123762586 missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123781055 critical splice donor site probably null
R5171:Kntc1 UTSW 5 123799844 missense probably benign 0.01
R5220:Kntc1 UTSW 5 123812097 missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123794172 missense probably benign 0.09
R5278:Kntc1 UTSW 5 123781014 missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123764191 missense probably benign 0.02
R5496:Kntc1 UTSW 5 123784182 missense probably benign 0.00
R5503:Kntc1 UTSW 5 123819876 missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123819057 missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123818475 missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123765007 missense probably benign 0.00
R5757:Kntc1 UTSW 5 123807309 critical splice donor site probably null
R5773:Kntc1 UTSW 5 123794157 missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123786195 missense probably benign 0.05
R6019:Kntc1 UTSW 5 123762516 missense probably benign 0.03
R6230:Kntc1 UTSW 5 123789009 splice site probably null
R6437:Kntc1 UTSW 5 123769691 missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123811310 missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123801825 missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123781726 missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123786973 missense probably benign 0.18
X0027:Kntc1 UTSW 5 123810929 missense probably benign 0.00
X0065:Kntc1 UTSW 5 123778037 nonsense probably null
X0067:Kntc1 UTSW 5 123778074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AACATCTGCTCTTGGGCTCC -3'
(R):5'- GGCACTGTGACAAATGCTAGAG -3'

Sequencing Primer
(F):5'- TAGTTCAAAGCCATCCTGGG -3'
(R):5'- TAGAGCAGTGCCAGGTGACTC -3'
Posted On2015-09-25