Incidental Mutation 'R4612:Tlr9'
ID344846
Institutional Source Beutler Lab
Gene Symbol Tlr9
Ensembl Gene ENSMUSG00000045322
Gene Nametoll-like receptor 9
Synonyms
MMRRC Submission 041823-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4612 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location106222598-106226883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106223807 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 99 (P99L)
Ref Sequence ENSEMBL: ENSMUSP00000082207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062241]
PDB Structure
Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000062241
AA Change: P99L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: P99L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,476 D31G probably benign Het
5730455P16Rik A T 11: 80,377,980 M1K probably null Het
Abca15 A G 7: 120,335,161 D120G probably benign Het
Adam26a A T 8: 43,568,793 N553K probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adam39 A T 8: 40,825,921 S450C probably damaging Het
Agap2 A T 10: 127,080,096 T159S unknown Het
Ahnak G A 19: 9,003,724 V791I probably benign Het
Ak7 T G 12: 105,761,513 L468R probably damaging Het
Akap12 A G 10: 4,354,456 D422G probably damaging Het
Antxr1 T A 6: 87,288,173 I129F probably damaging Het
Arhgap32 G A 9: 32,259,479 G1185D probably damaging Het
Atf7ip2 A T 16: 10,241,563 E322D probably benign Het
Atg4b T C 1: 93,786,541 F349L probably damaging Het
Atp6v1c1 A G 15: 38,677,612 K127R probably damaging Het
Atxn1l C T 8: 109,732,104 V509M possibly damaging Het
B3glct T A 5: 149,739,557 I260N probably damaging Het
Bcl2l12 G A 7: 44,996,585 P70L probably damaging Het
Bok T A 1: 93,694,178 F157L probably damaging Het
Bves G A 10: 45,339,277 G16D probably benign Het
Cacna1b T A 2: 24,626,852 K65* probably null Het
Casc3 A G 11: 98,822,958 T339A probably benign Het
Ccdc18 C T 5: 108,135,441 S6L probably benign Het
Cd86 A G 16: 36,615,330 Y242H probably benign Het
Chd3 A C 11: 69,353,209 Y1249* probably null Het
Chrne T C 11: 70,617,022 T284A probably damaging Het
Col12a1 T C 9: 79,616,057 D2746G probably damaging Het
Cryaa T A 17: 31,678,474 M72K probably benign Het
Csmd1 G T 8: 15,921,908 probably null Het
Det1 A T 7: 78,843,706 N183K probably damaging Het
Dis3 C A 14: 99,091,435 V294L probably benign Het
Dnah2 G A 11: 69,483,367 L1493F possibly damaging Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dsg4 T A 18: 20,462,413 S558T probably benign Het
Dzip3 A T 16: 48,952,040 L422* probably null Het
Elp6 T C 9: 110,314,019 F100S probably damaging Het
Epg5 C T 18: 77,982,414 T1224I possibly damaging Het
F830016B08Rik T A 18: 60,301,015 I390N probably benign Het
Fam110c A G 12: 31,074,656 T206A unknown Het
Fam160a1 G A 3: 85,730,372 R207* probably null Het
Fam187b G A 7: 30,977,093 G9D possibly damaging Het
Fat1 A G 8: 45,025,147 D2410G probably damaging Het
Fbln1 T A 15: 85,238,559 F390Y probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Flcn T C 11: 59,792,687 T555A probably damaging Het
Foxq1 G T 13: 31,558,825 probably benign Het
Gm3233 A T 10: 77,759,664 probably benign Het
Gm5346 A T 8: 43,626,550 F212L probably benign Het
Gm7271 A T 5: 76,516,498 N145Y probably damaging Het
Gprc5a G A 6: 135,078,929 V125I probably damaging Het
Gria2 T C 3: 80,732,051 D218G probably damaging Het
Gtf3c5 C T 2: 28,579,584 A103T probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Hspg2 A G 4: 137,539,575 T1964A possibly damaging Het
Htatip2 G T 7: 49,772,597 E188* probably null Het
Ifna13 T G 4: 88,643,876 E170D probably damaging Het
Il4ra A G 7: 125,576,083 T488A probably benign Het
Jup G T 11: 100,381,834 H251N probably damaging Het
Kif21a A T 15: 90,968,223 probably null Het
Klhl28 T A 12: 64,957,260 I160L probably damaging Het
Klk5 A T 7: 43,845,272 T60S possibly damaging Het
Kntc1 A G 5: 123,812,643 R1995G probably damaging Het
Lrig2 A C 3: 104,462,783 I844M probably damaging Het
Lrp2 C T 2: 69,458,427 W3698* probably null Het
Lyar T A 5: 38,224,709 S12T possibly damaging Het
Map3k19 T C 1: 127,815,300 K1507E probably benign Het
Mre11a G A 9: 14,802,903 G267R probably damaging Het
Mthfd1l A G 10: 4,030,717 Q473R probably damaging Het
Ncald T A 15: 37,397,349 E29V probably benign Het
Neb T C 2: 52,287,243 D1362G probably damaging Het
Nme2 T C 11: 93,955,602 T7A possibly damaging Het
Nod2 T A 8: 88,665,036 L657Q possibly damaging Het
Nrm T A 17: 35,863,529 V75E probably benign Het
Ogfod1 A C 8: 94,037,347 K20T possibly damaging Het
Olfr197 T C 16: 59,186,311 I57M probably damaging Het
Olfr294 T A 7: 86,615,736 Q303L probably benign Het
Olfr63 T A 17: 33,269,480 V252E probably benign Het
Omp T C 7: 98,145,141 N93S probably damaging Het
Pcdhb15 A C 18: 37,475,595 T627P probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pogk C A 1: 166,398,765 E606* probably null Het
Ppp1r10 T A 17: 35,927,931 L292Q probably damaging Het
Prpf6 T C 2: 181,632,079 C339R possibly damaging Het
Psd T A 19: 46,313,339 D937V probably benign Het
Rbak T C 5: 143,174,467 Q277R probably benign Het
Sbno1 T A 5: 124,404,024 Y355F probably damaging Het
Sec23ip C T 7: 128,750,502 Q201* probably null Het
Serpinb3a T C 1: 107,047,607 K157E probably damaging Het
Slc22a28 A T 19: 8,101,406 N306K probably damaging Het
Smarca2 C A 19: 26,776,225 D1584E possibly damaging Het
Snx29 C A 16: 11,447,495 Q530K probably damaging Het
Stard10 C A 7: 101,345,670 Q278K possibly damaging Het
Tgm2 C T 2: 158,124,204 C510Y probably benign Het
Tmco4 T C 4: 138,990,560 W4R probably benign Het
Tmem151a T A 19: 5,071,834 probably benign Het
Tmem255b T C 8: 13,454,228 V140A probably benign Het
Trbj1-2 C T 6: 41,534,016 probably benign Het
Trpm2 T C 10: 77,945,916 T290A probably damaging Het
Tsc22d1 G A 14: 76,419,005 E120K possibly damaging Het
Ttc29 A G 8: 78,325,546 D352G probably benign Het
Usp25 A T 16: 77,033,945 I30F possibly damaging Het
Usp34 A C 11: 23,432,268 N1993T probably damaging Het
Vmn2r124 A C 17: 18,063,022 H326P probably benign Het
Vmn2r92 C A 17: 18,166,870 T157K probably benign Het
Vstm5 A T 9: 15,257,493 I118F probably benign Het
Vwa7 T C 17: 35,023,450 V510A probably damaging Het
Zfhx4 G A 3: 5,397,063 S1266N probably damaging Het
Zfp763 T A 17: 33,018,948 N408Y probably benign Het
Zswim5 C T 4: 116,986,704 H980Y probably damaging Het
Other mutations in Tlr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
cpg7 UTSW 9 106225349 missense probably benign 0.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6393:Tlr9 UTSW 9 106224937 missense probably damaging 1.00
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGAGCTGAAGCCTCATG -3'
(R):5'- AGAACGCGCAGGCTGTATAG -3'

Sequencing Primer
(F):5'- CTCATGGCCTGGTGGACTG -3'
(R):5'- CTGTTAGCATCTAGAACCAGGATG -3'
Posted On2015-09-25