Incidental Mutation 'R4612:Mthfd1l'
ID344849
Institutional Source Beutler Lab
Gene Symbol Mthfd1l
Ensembl Gene ENSMUSG00000040675
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
SynonymsFthfsdc1, 2410004L15Rik
MMRRC Submission 041823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4612 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location3973118-4167081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4030717 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 473 (Q473R)
Ref Sequence ENSEMBL: ENSMUSP00000112897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043735] [ENSMUST00000117291] [ENSMUST00000120585]
Predicted Effect probably damaging
Transcript: ENSMUST00000043735
AA Change: Q473R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036178
Gene: ENSMUSG00000040675
AA Change: Q473R

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117291
AA Change: Q473R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112870
Gene: ENSMUSG00000040675
AA Change: Q473R

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120585
AA Change: Q473R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112897
Gene: ENSMUSG00000040675
AA Change: Q473R

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 70 179 8e-17 PFAM
Pfam:THF_DHG_CYH_C 182 337 5.4e-28 PFAM
Pfam:FTHFS 359 977 7.2e-260 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154517
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality, delayed embryonic growth, craniofacial anomalies, and neural tube defects including craniorachischisis, exencephaly and/or a wavy neural tube. Maternal formate supplementation reduces the incidence of NTDs and improves embryonic growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,476 D31G probably benign Het
5730455P16Rik A T 11: 80,377,980 M1K probably null Het
Abca15 A G 7: 120,335,161 D120G probably benign Het
Adam26a A T 8: 43,568,793 N553K probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adam39 A T 8: 40,825,921 S450C probably damaging Het
Agap2 A T 10: 127,080,096 T159S unknown Het
Ahnak G A 19: 9,003,724 V791I probably benign Het
Ak7 T G 12: 105,761,513 L468R probably damaging Het
Akap12 A G 10: 4,354,456 D422G probably damaging Het
Antxr1 T A 6: 87,288,173 I129F probably damaging Het
Arhgap32 G A 9: 32,259,479 G1185D probably damaging Het
Atf7ip2 A T 16: 10,241,563 E322D probably benign Het
Atg4b T C 1: 93,786,541 F349L probably damaging Het
Atp6v1c1 A G 15: 38,677,612 K127R probably damaging Het
Atxn1l C T 8: 109,732,104 V509M possibly damaging Het
B3glct T A 5: 149,739,557 I260N probably damaging Het
Bcl2l12 G A 7: 44,996,585 P70L probably damaging Het
Bok T A 1: 93,694,178 F157L probably damaging Het
Bves G A 10: 45,339,277 G16D probably benign Het
Cacna1b T A 2: 24,626,852 K65* probably null Het
Casc3 A G 11: 98,822,958 T339A probably benign Het
Ccdc18 C T 5: 108,135,441 S6L probably benign Het
Cd86 A G 16: 36,615,330 Y242H probably benign Het
Chd3 A C 11: 69,353,209 Y1249* probably null Het
Chrne T C 11: 70,617,022 T284A probably damaging Het
Col12a1 T C 9: 79,616,057 D2746G probably damaging Het
Cryaa T A 17: 31,678,474 M72K probably benign Het
Csmd1 G T 8: 15,921,908 probably null Het
Det1 A T 7: 78,843,706 N183K probably damaging Het
Dis3 C A 14: 99,091,435 V294L probably benign Het
Dnah2 G A 11: 69,483,367 L1493F possibly damaging Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dsg4 T A 18: 20,462,413 S558T probably benign Het
Dzip3 A T 16: 48,952,040 L422* probably null Het
Elp6 T C 9: 110,314,019 F100S probably damaging Het
Epg5 C T 18: 77,982,414 T1224I possibly damaging Het
F830016B08Rik T A 18: 60,301,015 I390N probably benign Het
Fam110c A G 12: 31,074,656 T206A unknown Het
Fam160a1 G A 3: 85,730,372 R207* probably null Het
Fam187b G A 7: 30,977,093 G9D possibly damaging Het
Fat1 A G 8: 45,025,147 D2410G probably damaging Het
Fbln1 T A 15: 85,238,559 F390Y probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Flcn T C 11: 59,792,687 T555A probably damaging Het
Foxq1 G T 13: 31,558,825 probably benign Het
Gm3233 A T 10: 77,759,664 probably benign Het
Gm5346 A T 8: 43,626,550 F212L probably benign Het
Gm7271 A T 5: 76,516,498 N145Y probably damaging Het
Gprc5a G A 6: 135,078,929 V125I probably damaging Het
Gria2 T C 3: 80,732,051 D218G probably damaging Het
Gtf3c5 C T 2: 28,579,584 A103T probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Hspg2 A G 4: 137,539,575 T1964A possibly damaging Het
Htatip2 G T 7: 49,772,597 E188* probably null Het
Ifna13 T G 4: 88,643,876 E170D probably damaging Het
Il4ra A G 7: 125,576,083 T488A probably benign Het
Jup G T 11: 100,381,834 H251N probably damaging Het
Kif21a A T 15: 90,968,223 probably null Het
Klhl28 T A 12: 64,957,260 I160L probably damaging Het
Klk5 A T 7: 43,845,272 T60S possibly damaging Het
Kntc1 A G 5: 123,812,643 R1995G probably damaging Het
Lrig2 A C 3: 104,462,783 I844M probably damaging Het
Lrp2 C T 2: 69,458,427 W3698* probably null Het
Lyar T A 5: 38,224,709 S12T possibly damaging Het
Map3k19 T C 1: 127,815,300 K1507E probably benign Het
Mre11a G A 9: 14,802,903 G267R probably damaging Het
Ncald T A 15: 37,397,349 E29V probably benign Het
Neb T C 2: 52,287,243 D1362G probably damaging Het
Nme2 T C 11: 93,955,602 T7A possibly damaging Het
Nod2 T A 8: 88,665,036 L657Q possibly damaging Het
Nrm T A 17: 35,863,529 V75E probably benign Het
Ogfod1 A C 8: 94,037,347 K20T possibly damaging Het
Olfr197 T C 16: 59,186,311 I57M probably damaging Het
Olfr294 T A 7: 86,615,736 Q303L probably benign Het
Olfr63 T A 17: 33,269,480 V252E probably benign Het
Omp T C 7: 98,145,141 N93S probably damaging Het
Pcdhb15 A C 18: 37,475,595 T627P probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pogk C A 1: 166,398,765 E606* probably null Het
Ppp1r10 T A 17: 35,927,931 L292Q probably damaging Het
Prpf6 T C 2: 181,632,079 C339R possibly damaging Het
Psd T A 19: 46,313,339 D937V probably benign Het
Rbak T C 5: 143,174,467 Q277R probably benign Het
Sbno1 T A 5: 124,404,024 Y355F probably damaging Het
Sec23ip C T 7: 128,750,502 Q201* probably null Het
Serpinb3a T C 1: 107,047,607 K157E probably damaging Het
Slc22a28 A T 19: 8,101,406 N306K probably damaging Het
Smarca2 C A 19: 26,776,225 D1584E possibly damaging Het
Snx29 C A 16: 11,447,495 Q530K probably damaging Het
Stard10 C A 7: 101,345,670 Q278K possibly damaging Het
Tgm2 C T 2: 158,124,204 C510Y probably benign Het
Tlr9 C T 9: 106,223,807 P99L probably damaging Het
Tmco4 T C 4: 138,990,560 W4R probably benign Het
Tmem151a T A 19: 5,071,834 probably benign Het
Tmem255b T C 8: 13,454,228 V140A probably benign Het
Trbj1-2 C T 6: 41,534,016 probably benign Het
Trpm2 T C 10: 77,945,916 T290A probably damaging Het
Tsc22d1 G A 14: 76,419,005 E120K possibly damaging Het
Ttc29 A G 8: 78,325,546 D352G probably benign Het
Usp25 A T 16: 77,033,945 I30F possibly damaging Het
Usp34 A C 11: 23,432,268 N1993T probably damaging Het
Vmn2r124 A C 17: 18,063,022 H326P probably benign Het
Vmn2r92 C A 17: 18,166,870 T157K probably benign Het
Vstm5 A T 9: 15,257,493 I118F probably benign Het
Vwa7 T C 17: 35,023,450 V510A probably damaging Het
Zfhx4 G A 3: 5,397,063 S1266N probably damaging Het
Zfp763 T A 17: 33,018,948 N408Y probably benign Het
Zswim5 C T 4: 116,986,704 H980Y probably damaging Het
Other mutations in Mthfd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Mthfd1l APN 10 3989971 synonymous probably benign
IGL01013:Mthfd1l APN 10 4030716 missense probably damaging 1.00
IGL01018:Mthfd1l APN 10 3978708 missense probably benign
IGL01018:Mthfd1l APN 10 4007800 missense probably benign
IGL01018:Mthfd1l APN 10 4032345 splice site probably benign
IGL01068:Mthfd1l APN 10 4028428 missense probably damaging 1.00
IGL01584:Mthfd1l APN 10 4016738 missense probably damaging 0.97
IGL01609:Mthfd1l APN 10 4018567 missense probably benign 0.00
IGL02272:Mthfd1l APN 10 4041812 missense probably damaging 0.99
IGL02344:Mthfd1l APN 10 4048272 splice site probably null
IGL02429:Mthfd1l APN 10 4089334 missense probably damaging 1.00
IGL02503:Mthfd1l APN 10 4083824 missense probably damaging 1.00
IGL02748:Mthfd1l APN 10 4018587 missense possibly damaging 0.94
IGL02748:Mthfd1l APN 10 3980268 critical splice donor site probably null
IGL03031:Mthfd1l APN 10 4018601 critical splice donor site probably null
IGL03047:Mthfd1l APN 10 3980409 splice site probably benign
IGL03215:Mthfd1l APN 10 4041826 missense probably benign 0.14
IGL03367:Mthfd1l APN 10 4106536 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0107:Mthfd1l UTSW 10 4041838 missense probably benign
R0348:Mthfd1l UTSW 10 4056766 missense probably damaging 1.00
R0496:Mthfd1l UTSW 10 4090006 missense probably benign
R0658:Mthfd1l UTSW 10 4047976 splice site probably null
R1177:Mthfd1l UTSW 10 3985661 missense possibly damaging 0.82
R1676:Mthfd1l UTSW 10 4083877 critical splice donor site probably null
R1703:Mthfd1l UTSW 10 4148093 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1891:Mthfd1l UTSW 10 4032284 nonsense probably null
R2014:Mthfd1l UTSW 10 4047894 missense probably benign
R2061:Mthfd1l UTSW 10 4103288 missense probably benign 0.00
R2197:Mthfd1l UTSW 10 4028399 missense probably damaging 1.00
R2360:Mthfd1l UTSW 10 4056771 missense probably damaging 1.00
R3085:Mthfd1l UTSW 10 4090007 missense probably benign 0.00
R3176:Mthfd1l UTSW 10 4148025 missense probably damaging 1.00
R3276:Mthfd1l UTSW 10 4148025 missense probably damaging 1.00
R4065:Mthfd1l UTSW 10 4032242 missense probably damaging 1.00
R4803:Mthfd1l UTSW 10 4007840 missense possibly damaging 0.52
R4883:Mthfd1l UTSW 10 4007775 missense probably benign 0.11
R4932:Mthfd1l UTSW 10 3980241 missense probably benign 0.00
R5507:Mthfd1l UTSW 10 4106432 missense probably benign 0.20
R5687:Mthfd1l UTSW 10 3990002 splice site probably null
R5694:Mthfd1l UTSW 10 4035239 missense possibly damaging 0.90
R5727:Mthfd1l UTSW 10 4103302 missense possibly damaging 0.86
R5908:Mthfd1l UTSW 10 4089392 missense probably damaging 1.00
R5951:Mthfd1l UTSW 10 4048222 missense probably damaging 1.00
R6330:Mthfd1l UTSW 10 3980234 missense probably benign
R6583:Mthfd1l UTSW 10 4047937 missense probably damaging 0.96
R6846:Mthfd1l UTSW 10 4047898 missense probably damaging 1.00
R7105:Mthfd1l UTSW 10 4103261 missense probably benign
X0003:Mthfd1l UTSW 10 4089303 missense probably damaging 0.99
Z1088:Mthfd1l UTSW 10 4007844 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGAAGGCACAGGTCTTTTC -3'
(R):5'- AGCCTGGGAACATGAAACTG -3'

Sequencing Primer
(F):5'- CCTAAAATGGCATCTCTGGAAAC -3'
(R):5'- CCTGGGAACATGAAACTGTTATG -3'
Posted On2015-09-25