Incidental Mutation 'R0103:Gnptab'
ID34485
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene NameN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
SynonymsEG432486
MMRRC Submission 038389-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R0103 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location88379132-88447329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88429519 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 331 (Y331C)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
Predicted Effect probably damaging
Transcript: ENSMUST00000020251
AA Change: Y331C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: Y331C

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.498 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,273,951 R443S probably damaging Het
Anapc1 T C 2: 128,680,452 probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arfgap3 A T 15: 83,322,721 probably benign Het
Asah2 G T 19: 32,018,977 H374N probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Ccdc106 C A 7: 5,057,545 Q35K probably benign Het
Ccm2l G T 2: 153,067,919 E64* probably null Het
Cep85l A T 10: 53,278,174 D776E possibly damaging Het
Cfap52 T A 11: 67,925,125 I611F possibly damaging Het
Cldn22 C T 8: 47,824,554 T9M probably benign Het
Coa7 T C 4: 108,338,141 L89P possibly damaging Het
Cox7a2l A T 17: 83,514,272 Y2N probably damaging Het
Ctns A C 11: 73,185,311 I299M probably damaging Het
Cyp27a1 A C 1: 74,735,915 E301A probably benign Het
Cyp2b13 A T 7: 26,088,710 K421M probably damaging Het
Cyp4f40 G T 17: 32,676,308 C468F probably damaging Het
Cyp4f40 C A 17: 32,676,309 C468* probably null Het
Dcun1d5 G A 9: 7,188,788 C74Y probably damaging Het
Dennd4c A G 4: 86,812,446 Y860C probably benign Het
Dgkz T C 2: 91,934,205 T1028A probably benign Het
Dhx58 T C 11: 100,695,270 T642A probably damaging Het
Dlg4 A G 11: 70,031,193 Y87C probably damaging Het
Dnah6 C T 6: 73,092,172 E2511K probably damaging Het
Entpd5 C A 12: 84,396,943 E9* probably null Het
Fbln2 A C 6: 91,271,550 I1066L probably benign Het
Fhl2 C T 1: 43,153,221 R4H probably benign Het
Frmpd1 T A 4: 45,229,884 I17K probably damaging Het
Gbp7 T A 3: 142,546,538 N627K probably benign Het
Gm20388 A G 8: 122,269,733 probably benign Het
Hdac4 T C 1: 91,975,644 E521G possibly damaging Het
Hibadh T A 6: 52,557,877 M173L probably benign Het
Iba57 C T 11: 59,163,613 A27T probably benign Het
Itga1 T C 13: 115,016,254 I211V probably benign Het
Keg1 A T 19: 12,718,916 I155F possibly damaging Het
Krt84 T C 15: 101,530,236 E272G probably damaging Het
Lrp2 C A 2: 69,477,040 V2892L probably benign Het
Ltb A G 17: 35,195,040 probably benign Het
Masp1 G A 16: 23,458,018 P579L probably damaging Het
Mtor T A 4: 148,533,902 M1724K probably benign Het
Myo3a T G 2: 22,544,322 probably benign Het
Myo9b C T 8: 71,323,849 probably benign Het
Ncor1 G T 11: 62,343,045 Q444K possibly damaging Het
Nek7 A T 1: 138,544,242 C53* probably null Het
Obscn G T 11: 59,062,696 Y4044* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Pcdh15 A T 10: 74,210,425 D178V probably damaging Het
Pcsk6 T C 7: 65,929,097 probably benign Het
Phxr4 T C 9: 13,431,791 probably benign Het
Pkhd1 T A 1: 20,523,359 D1510V probably benign Het
Pkhd1l1 T C 15: 44,597,141 C4249R probably benign Het
Plxnb2 A G 15: 89,161,769 Y968H possibly damaging Het
Prpf39 T C 12: 65,055,283 V378A possibly damaging Het
Psd2 A G 18: 36,004,717 N455S probably damaging Het
Ptch2 C A 4: 117,109,425 probably benign Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rad9b A T 5: 122,331,527 V348E probably damaging Het
Rcor1 T C 12: 111,109,778 probably benign Het
Rhoc A T 3: 104,791,991 E32V possibly damaging Het
Rnf40 T G 7: 127,600,571 V925G probably damaging Het
Rptor G T 11: 119,884,967 R988L probably benign Het
Slc25a32 A T 15: 39,099,897 Y176* probably null Het
Slc7a1 T A 5: 148,352,426 K4* probably null Het
Ss18 A C 18: 14,679,421 Y38D probably damaging Het
Syt4 T A 18: 31,447,220 probably benign Het
Taar4 A T 10: 23,961,406 N305Y probably damaging Het
Taar7b A T 10: 24,000,294 Y119F probably benign Het
Tcaf1 G T 6: 42,686,390 D185E probably benign Het
Tmem138 T C 19: 10,574,952 N62S possibly damaging Het
Tnfaip2 C T 12: 111,445,810 T215M probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnfrsf25 C T 4: 152,116,948 P65S possibly damaging Het
Trp53bp1 A T 2: 121,236,759 S495R possibly damaging Het
Trpv3 T C 11: 73,293,979 F597S probably damaging Het
Tsc22d4 A C 5: 137,747,116 M1L possibly damaging Het
Ttc39a A G 4: 109,421,453 probably null Het
Ttn T G 2: 76,761,226 H21033P probably damaging Het
Ugt2a3 A G 5: 87,336,718 V149A possibly damaging Het
Ush2a T G 1: 188,319,070 I251R possibly damaging Het
Vamp4 T C 1: 162,589,539 C114R possibly damaging Het
Wdr33 T C 18: 31,833,335 V135A probably damaging Het
Zc3h13 T A 14: 75,330,468 V1067E probably damaging Het
Zcwpw1 G A 5: 137,810,113 W274* probably null Het
Zfp219 T A 14: 52,006,706 H627L probably damaging Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0114:Gnptab UTSW 10 88433400 missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88436525 missense probably damaging 1.00
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88440305 nonsense probably null
R2118:Gnptab UTSW 10 88436398 missense probably benign 0.13
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4434:Gnptab UTSW 10 88412622 missense probably damaging 1.00
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4776:Gnptab UTSW 10 88436528 missense probably damaging 1.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4880:Gnptab UTSW 10 88432551 nonsense probably null
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6027:Gnptab UTSW 10 88433225 missense probably damaging 0.98
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6119:Gnptab UTSW 10 88431395 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R7094:Gnptab UTSW 10 88379504 missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88440312 missense probably benign 0.19
R7164:Gnptab UTSW 10 88434070 nonsense probably null
R7214:Gnptab UTSW 10 88379157 unclassified probably benign
R7316:Gnptab UTSW 10 88400710 missense probably damaging 1.00
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTGAGAGCAGAGCAGGCA -3'
(R):5'- GAATGTGACTTTCAATAGCAGGGGAACT -3'

Sequencing Primer
(F):5'- GCAAAGGATGAAGACGAGCTG -3'
(R):5'- GACATCGTGAGATCACTGTACC -3'
Posted On2013-05-09