Incidental Mutation 'R4612:Chrne'
ID344861
Institutional Source Beutler Lab
Gene Symbol Chrne
Ensembl Gene ENSMUSG00000014609
Gene Namecholinergic receptor, nicotinic, epsilon polypeptide
SynonymsAChrepsilon, Acre
MMRRC Submission 041823-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4612 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70614883-70619216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70617022 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 284 (T284A)
Ref Sequence ENSEMBL: ENSMUSP00000099616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014753] [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102556] [ENSMUST00000102558] [ENSMUST00000102559] [ENSMUST00000135865] [ENSMUST00000144960] [ENSMUST00000180052]
Predicted Effect probably damaging
Transcript: ENSMUST00000014753
AA Change: T284A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000014753
Gene: ENSMUSG00000014609
AA Change: T284A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 2.9e-65 PFAM
Pfam:Neur_chan_memb 247 475 6.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072237
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072873
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079244
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102556
AA Change: T284A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099616
Gene: ENSMUSG00000014609
AA Change: T284A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 5.4e-65 PFAM
Pfam:Neur_chan_memb 247 474 2.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102558
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102559
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134836
Predicted Effect probably benign
Transcript: ENSMUST00000135865
SMART Domains Protein: ENSMUSP00000135933
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 101 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135920
Predicted Effect probably benign
Transcript: ENSMUST00000136663
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144960
SMART Domains Protein: ENSMUSP00000136077
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180052
SMART Domains Protein: ENSMUSP00000137259
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the epsilon subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. In mice, deficiency of this gene can lead to a decline in the number of nicotinic acetylcholine receptors at neuromuscular junctions and causes progressive muscle weakness, atrophy and premature death. Mutations in this gene serve as a pathophysiological model for human congenital myasthenia. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced AChR receptor density at neuromuscular synapses, impaired neuromuscular transmission, progressive muscular weakness and atrophy, and lethality at 2-3 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,476 D31G probably benign Het
5730455P16Rik A T 11: 80,377,980 M1K probably null Het
Abca15 A G 7: 120,335,161 D120G probably benign Het
Adam26a A T 8: 43,568,793 N553K probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adam39 A T 8: 40,825,921 S450C probably damaging Het
Agap2 A T 10: 127,080,096 T159S unknown Het
Ahnak G A 19: 9,003,724 V791I probably benign Het
Ak7 T G 12: 105,761,513 L468R probably damaging Het
Akap12 A G 10: 4,354,456 D422G probably damaging Het
Antxr1 T A 6: 87,288,173 I129F probably damaging Het
Arhgap32 G A 9: 32,259,479 G1185D probably damaging Het
Atf7ip2 A T 16: 10,241,563 E322D probably benign Het
Atg4b T C 1: 93,786,541 F349L probably damaging Het
Atp6v1c1 A G 15: 38,677,612 K127R probably damaging Het
Atxn1l C T 8: 109,732,104 V509M possibly damaging Het
B3glct T A 5: 149,739,557 I260N probably damaging Het
Bcl2l12 G A 7: 44,996,585 P70L probably damaging Het
Bok T A 1: 93,694,178 F157L probably damaging Het
Bves G A 10: 45,339,277 G16D probably benign Het
Cacna1b T A 2: 24,626,852 K65* probably null Het
Casc3 A G 11: 98,822,958 T339A probably benign Het
Ccdc18 C T 5: 108,135,441 S6L probably benign Het
Cd86 A G 16: 36,615,330 Y242H probably benign Het
Chd3 A C 11: 69,353,209 Y1249* probably null Het
Col12a1 T C 9: 79,616,057 D2746G probably damaging Het
Cryaa T A 17: 31,678,474 M72K probably benign Het
Csmd1 G T 8: 15,921,908 probably null Het
Det1 A T 7: 78,843,706 N183K probably damaging Het
Dis3 C A 14: 99,091,435 V294L probably benign Het
Dnah2 G A 11: 69,483,367 L1493F possibly damaging Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dsg4 T A 18: 20,462,413 S558T probably benign Het
Dzip3 A T 16: 48,952,040 L422* probably null Het
Elp6 T C 9: 110,314,019 F100S probably damaging Het
Epg5 C T 18: 77,982,414 T1224I possibly damaging Het
F830016B08Rik T A 18: 60,301,015 I390N probably benign Het
Fam110c A G 12: 31,074,656 T206A unknown Het
Fam160a1 G A 3: 85,730,372 R207* probably null Het
Fam187b G A 7: 30,977,093 G9D possibly damaging Het
Fat1 A G 8: 45,025,147 D2410G probably damaging Het
Fbln1 T A 15: 85,238,559 F390Y probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Flcn T C 11: 59,792,687 T555A probably damaging Het
Foxq1 G T 13: 31,558,825 probably benign Het
Gm3233 A T 10: 77,759,664 probably benign Het
Gm5346 A T 8: 43,626,550 F212L probably benign Het
Gm7271 A T 5: 76,516,498 N145Y probably damaging Het
Gprc5a G A 6: 135,078,929 V125I probably damaging Het
Gria2 T C 3: 80,732,051 D218G probably damaging Het
Gtf3c5 C T 2: 28,579,584 A103T probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Hspg2 A G 4: 137,539,575 T1964A possibly damaging Het
Htatip2 G T 7: 49,772,597 E188* probably null Het
Ifna13 T G 4: 88,643,876 E170D probably damaging Het
Il4ra A G 7: 125,576,083 T488A probably benign Het
Jup G T 11: 100,381,834 H251N probably damaging Het
Kif21a A T 15: 90,968,223 probably null Het
Klhl28 T A 12: 64,957,260 I160L probably damaging Het
Klk5 A T 7: 43,845,272 T60S possibly damaging Het
Kntc1 A G 5: 123,812,643 R1995G probably damaging Het
Lrig2 A C 3: 104,462,783 I844M probably damaging Het
Lrp2 C T 2: 69,458,427 W3698* probably null Het
Lyar T A 5: 38,224,709 S12T possibly damaging Het
Map3k19 T C 1: 127,815,300 K1507E probably benign Het
Mre11a G A 9: 14,802,903 G267R probably damaging Het
Mthfd1l A G 10: 4,030,717 Q473R probably damaging Het
Ncald T A 15: 37,397,349 E29V probably benign Het
Neb T C 2: 52,287,243 D1362G probably damaging Het
Nme2 T C 11: 93,955,602 T7A possibly damaging Het
Nod2 T A 8: 88,665,036 L657Q possibly damaging Het
Nrm T A 17: 35,863,529 V75E probably benign Het
Ogfod1 A C 8: 94,037,347 K20T possibly damaging Het
Olfr197 T C 16: 59,186,311 I57M probably damaging Het
Olfr294 T A 7: 86,615,736 Q303L probably benign Het
Olfr63 T A 17: 33,269,480 V252E probably benign Het
Omp T C 7: 98,145,141 N93S probably damaging Het
Pcdhb15 A C 18: 37,475,595 T627P probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pogk C A 1: 166,398,765 E606* probably null Het
Ppp1r10 T A 17: 35,927,931 L292Q probably damaging Het
Prpf6 T C 2: 181,632,079 C339R possibly damaging Het
Psd T A 19: 46,313,339 D937V probably benign Het
Rbak T C 5: 143,174,467 Q277R probably benign Het
Sbno1 T A 5: 124,404,024 Y355F probably damaging Het
Sec23ip C T 7: 128,750,502 Q201* probably null Het
Serpinb3a T C 1: 107,047,607 K157E probably damaging Het
Slc22a28 A T 19: 8,101,406 N306K probably damaging Het
Smarca2 C A 19: 26,776,225 D1584E possibly damaging Het
Snx29 C A 16: 11,447,495 Q530K probably damaging Het
Stard10 C A 7: 101,345,670 Q278K possibly damaging Het
Tgm2 C T 2: 158,124,204 C510Y probably benign Het
Tlr9 C T 9: 106,223,807 P99L probably damaging Het
Tmco4 T C 4: 138,990,560 W4R probably benign Het
Tmem151a T A 19: 5,071,834 probably benign Het
Tmem255b T C 8: 13,454,228 V140A probably benign Het
Trbj1-2 C T 6: 41,534,016 probably benign Het
Trpm2 T C 10: 77,945,916 T290A probably damaging Het
Tsc22d1 G A 14: 76,419,005 E120K possibly damaging Het
Ttc29 A G 8: 78,325,546 D352G probably benign Het
Usp25 A T 16: 77,033,945 I30F possibly damaging Het
Usp34 A C 11: 23,432,268 N1993T probably damaging Het
Vmn2r124 A C 17: 18,063,022 H326P probably benign Het
Vmn2r92 C A 17: 18,166,870 T157K probably benign Het
Vstm5 A T 9: 15,257,493 I118F probably benign Het
Vwa7 T C 17: 35,023,450 V510A probably damaging Het
Zfhx4 G A 3: 5,397,063 S1266N probably damaging Het
Zfp763 T A 17: 33,018,948 N408Y probably benign Het
Zswim5 C T 4: 116,986,704 H980Y probably damaging Het
Other mutations in Chrne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Chrne APN 11 70615762 missense probably benign 0.00
IGL00950:Chrne APN 11 70619157 unclassified probably benign
IGL01875:Chrne APN 11 70618672 splice site probably null
IGL03201:Chrne APN 11 70618512 missense probably benign 0.02
IGL03303:Chrne APN 11 70615100 missense possibly damaging 0.77
pip-squeak UTSW 11 70615130 critical splice acceptor site probably null
R0419:Chrne UTSW 11 70615723 missense probably benign
R0848:Chrne UTSW 11 70615413 missense probably benign 0.02
R1378:Chrne UTSW 11 70615130 critical splice acceptor site probably null
R1623:Chrne UTSW 11 70618428 missense possibly damaging 0.86
R2170:Chrne UTSW 11 70618497 missense probably damaging 1.00
R2437:Chrne UTSW 11 70615260 missense possibly damaging 0.92
R3945:Chrne UTSW 11 70617043 missense possibly damaging 0.95
R4923:Chrne UTSW 11 70615275 missense possibly damaging 0.62
R5172:Chrne UTSW 11 70615526 missense probably benign 0.00
R5288:Chrne UTSW 11 70615087 missense possibly damaging 0.63
R5384:Chrne UTSW 11 70615087 missense possibly damaging 0.63
R5614:Chrne UTSW 11 70615053 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GATAATCCATCACTGTCCCAGTCC -3'
(R):5'- TAACATCATTGTGCCTTGCGTG -3'

Sequencing Primer
(F):5'- CCCTGTGTCCAAATAAAAGTCCAG -3'
(R):5'- GCCTTGCGTGCTCATTTCTGG -3'
Posted On2015-09-25