Incidental Mutation 'R4612:Epg5'
ID344895
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission 041823-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R4612 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77982414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1224 (T1224I)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044622
AA Change: T1224I

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: T1224I

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,476 D31G probably benign Het
5730455P16Rik A T 11: 80,377,980 M1K probably null Het
Abca15 A G 7: 120,335,161 D120G probably benign Het
Adam26a A T 8: 43,568,793 N553K probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adam39 A T 8: 40,825,921 S450C probably damaging Het
Agap2 A T 10: 127,080,096 T159S unknown Het
Ahnak G A 19: 9,003,724 V791I probably benign Het
Ak7 T G 12: 105,761,513 L468R probably damaging Het
Akap12 A G 10: 4,354,456 D422G probably damaging Het
Antxr1 T A 6: 87,288,173 I129F probably damaging Het
Arhgap32 G A 9: 32,259,479 G1185D probably damaging Het
Atf7ip2 A T 16: 10,241,563 E322D probably benign Het
Atg4b T C 1: 93,786,541 F349L probably damaging Het
Atp6v1c1 A G 15: 38,677,612 K127R probably damaging Het
Atxn1l C T 8: 109,732,104 V509M possibly damaging Het
B3glct T A 5: 149,739,557 I260N probably damaging Het
Bcl2l12 G A 7: 44,996,585 P70L probably damaging Het
Bok T A 1: 93,694,178 F157L probably damaging Het
Bves G A 10: 45,339,277 G16D probably benign Het
Cacna1b T A 2: 24,626,852 K65* probably null Het
Casc3 A G 11: 98,822,958 T339A probably benign Het
Ccdc18 C T 5: 108,135,441 S6L probably benign Het
Cd86 A G 16: 36,615,330 Y242H probably benign Het
Chd3 A C 11: 69,353,209 Y1249* probably null Het
Chrne T C 11: 70,617,022 T284A probably damaging Het
Col12a1 T C 9: 79,616,057 D2746G probably damaging Het
Cryaa T A 17: 31,678,474 M72K probably benign Het
Csmd1 G T 8: 15,921,908 probably null Het
Det1 A T 7: 78,843,706 N183K probably damaging Het
Dis3 C A 14: 99,091,435 V294L probably benign Het
Dnah2 G A 11: 69,483,367 L1493F possibly damaging Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dsg4 T A 18: 20,462,413 S558T probably benign Het
Dzip3 A T 16: 48,952,040 L422* probably null Het
Elp6 T C 9: 110,314,019 F100S probably damaging Het
F830016B08Rik T A 18: 60,301,015 I390N probably benign Het
Fam110c A G 12: 31,074,656 T206A unknown Het
Fam160a1 G A 3: 85,730,372 R207* probably null Het
Fam187b G A 7: 30,977,093 G9D possibly damaging Het
Fat1 A G 8: 45,025,147 D2410G probably damaging Het
Fbln1 T A 15: 85,238,559 F390Y probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Flcn T C 11: 59,792,687 T555A probably damaging Het
Foxq1 G T 13: 31,558,825 probably benign Het
Gm3233 A T 10: 77,759,664 probably benign Het
Gm5346 A T 8: 43,626,550 F212L probably benign Het
Gm7271 A T 5: 76,516,498 N145Y probably damaging Het
Gprc5a G A 6: 135,078,929 V125I probably damaging Het
Gria2 T C 3: 80,732,051 D218G probably damaging Het
Gtf3c5 C T 2: 28,579,584 A103T probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Hspg2 A G 4: 137,539,575 T1964A possibly damaging Het
Htatip2 G T 7: 49,772,597 E188* probably null Het
Ifna13 T G 4: 88,643,876 E170D probably damaging Het
Il4ra A G 7: 125,576,083 T488A probably benign Het
Jup G T 11: 100,381,834 H251N probably damaging Het
Kif21a A T 15: 90,968,223 probably null Het
Klhl28 T A 12: 64,957,260 I160L probably damaging Het
Klk5 A T 7: 43,845,272 T60S possibly damaging Het
Kntc1 A G 5: 123,812,643 R1995G probably damaging Het
Lrig2 A C 3: 104,462,783 I844M probably damaging Het
Lrp2 C T 2: 69,458,427 W3698* probably null Het
Lyar T A 5: 38,224,709 S12T possibly damaging Het
Map3k19 T C 1: 127,815,300 K1507E probably benign Het
Mre11a G A 9: 14,802,903 G267R probably damaging Het
Mthfd1l A G 10: 4,030,717 Q473R probably damaging Het
Ncald T A 15: 37,397,349 E29V probably benign Het
Neb T C 2: 52,287,243 D1362G probably damaging Het
Nme2 T C 11: 93,955,602 T7A possibly damaging Het
Nod2 T A 8: 88,665,036 L657Q possibly damaging Het
Nrm T A 17: 35,863,529 V75E probably benign Het
Ogfod1 A C 8: 94,037,347 K20T possibly damaging Het
Olfr197 T C 16: 59,186,311 I57M probably damaging Het
Olfr294 T A 7: 86,615,736 Q303L probably benign Het
Olfr63 T A 17: 33,269,480 V252E probably benign Het
Omp T C 7: 98,145,141 N93S probably damaging Het
Pcdhb15 A C 18: 37,475,595 T627P probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pogk C A 1: 166,398,765 E606* probably null Het
Ppp1r10 T A 17: 35,927,931 L292Q probably damaging Het
Prpf6 T C 2: 181,632,079 C339R possibly damaging Het
Psd T A 19: 46,313,339 D937V probably benign Het
Rbak T C 5: 143,174,467 Q277R probably benign Het
Sbno1 T A 5: 124,404,024 Y355F probably damaging Het
Sec23ip C T 7: 128,750,502 Q201* probably null Het
Serpinb3a T C 1: 107,047,607 K157E probably damaging Het
Slc22a28 A T 19: 8,101,406 N306K probably damaging Het
Smarca2 C A 19: 26,776,225 D1584E possibly damaging Het
Snx29 C A 16: 11,447,495 Q530K probably damaging Het
Stard10 C A 7: 101,345,670 Q278K possibly damaging Het
Tgm2 C T 2: 158,124,204 C510Y probably benign Het
Tlr9 C T 9: 106,223,807 P99L probably damaging Het
Tmco4 T C 4: 138,990,560 W4R probably benign Het
Tmem151a T A 19: 5,071,834 probably benign Het
Tmem255b T C 8: 13,454,228 V140A probably benign Het
Trbj1-2 C T 6: 41,534,016 probably benign Het
Trpm2 T C 10: 77,945,916 T290A probably damaging Het
Tsc22d1 G A 14: 76,419,005 E120K possibly damaging Het
Ttc29 A G 8: 78,325,546 D352G probably benign Het
Usp25 A T 16: 77,033,945 I30F possibly damaging Het
Usp34 A C 11: 23,432,268 N1993T probably damaging Het
Vmn2r124 A C 17: 18,063,022 H326P probably benign Het
Vmn2r92 C A 17: 18,166,870 T157K probably benign Het
Vstm5 A T 9: 15,257,493 I118F probably benign Het
Vwa7 T C 17: 35,023,450 V510A probably damaging Het
Zfhx4 G A 3: 5,397,063 S1266N probably damaging Het
Zfp763 T A 17: 33,018,948 N408Y probably benign Het
Zswim5 C T 4: 116,986,704 H980Y probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTAATAGCCTTGGGTAGAGTC -3'
(R):5'- TGTTCTGAGTGCTATACATACAGC -3'

Sequencing Primer
(F):5'- ATAGCCTTGGGTAGAGTCAAAGTCTC -3'
(R):5'- TCATCTGACTGTGAGGAAACTG -3'
Posted On2015-09-25