Incidental Mutation 'R4614:Trmt1l'
ID344904
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene NametRNA methyltransferase 1 like
SynonymsTrm1-like, 1190005F20Rik
MMRRC Submission 041825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4614 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151428542-151458161 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 151454048 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 581 (Q581*)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655] [ENSMUST00000190070]
Predicted Effect probably null
Transcript: ENSMUST00000065625
AA Change: Q581*
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: Q581*

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188843
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190070
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Meta Mutation Damage Score 0.532 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T G 13: 77,254,256 probably null Het
4932414N04Rik C A 2: 68,745,460 T701K probably benign Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Abcb11 A T 2: 69,284,681 H640Q possibly damaging Het
Ago2 C T 15: 73,130,967 V139M probably damaging Het
Apol11a A T 15: 77,516,572 K86N probably benign Het
Ass1 T C 2: 31,514,783 Y359H probably damaging Het
Bpifa3 A T 2: 154,136,280 N34I probably damaging Het
Brwd1 A T 16: 96,047,359 L540H probably damaging Het
C3ar1 G A 6: 122,850,721 S179F probably benign Het
Ccnb1ip1 T C 14: 50,792,195 T137A probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Cdk12 T A 11: 98,249,777 probably benign Het
Cep290 T C 10: 100,508,740 M480T probably benign Het
Cep290 G A 10: 100,559,687 R2112K possibly damaging Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cpeb1 A T 7: 81,436,270 D41E possibly damaging Het
Csf2rb2 C G 15: 78,291,702 C184S probably damaging Het
Ctsc G A 7: 88,278,375 probably null Het
Cyp2c40 G A 19: 39,803,856 S191L probably damaging Het
Dagla T C 19: 10,248,277 E841G probably damaging Het
Dld A T 12: 31,333,945 Y386* probably null Het
Dpp8 G A 9: 65,066,396 S634N probably benign Het
Duox2 A T 2: 122,289,557 V824E probably damaging Het
Dync2h1 A C 9: 7,011,290 S3634R probably benign Het
Eef1d T C 15: 75,903,576 N78S probably benign Het
Fcrl5 T A 3: 87,448,426 I482N probably damaging Het
Fezf1 A T 6: 23,247,858 C73S possibly damaging Het
Fgfr1 A G 8: 25,557,797 D53G probably benign Het
Fmn1 T C 2: 113,365,149 L398S unknown Het
Gm17175 T C 14: 51,571,585 Q108R probably benign Het
Gm28042 G A 2: 120,041,158 G669D probably damaging Het
Gm6185 A G 1: 161,223,099 noncoding transcript Het
Gucy2g A T 19: 55,202,147 C1018* probably null Het
H2-Q10 A T 17: 35,474,020 probably benign Het
H2-T22 T G 17: 36,040,537 Q267P probably benign Het
Hibadh A G 6: 52,546,930 Y328H possibly damaging Het
Hsd3b3 T A 3: 98,742,080 Y309F probably benign Het
Ighv1-37 C T 12: 114,896,243 A116T probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Iqch A G 9: 63,482,581 M733T probably benign Het
Jakmip2 T A 18: 43,562,592 D539V probably damaging Het
Lgi2 A G 5: 52,538,433 S395P probably damaging Het
Lrrc40 A T 3: 158,054,634 N344I probably damaging Het
Ltbp1 G A 17: 75,289,994 probably benign Het
Metap1d C T 2: 71,524,948 P332L probably benign Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mis18bp1 T A 12: 65,153,529 probably benign Het
Mta2 T C 19: 8,948,128 probably null Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Muc4 A G 16: 32,757,058 K241E probably benign Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Nfs1 A G 2: 156,144,050 S31P probably benign Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr419 A G 1: 174,250,622 F102L possibly damaging Het
Olfr981 T A 9: 40,022,959 C189S probably damaging Het
Otogl A T 10: 107,892,124 C245* probably null Het
Pcdhb16 G A 18: 37,480,345 G786D probably benign Het
Pdcd5 C T 7: 35,647,047 probably benign Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Piezo1 A T 8: 122,486,411 I1871N probably benign Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Plxnd1 T C 6: 115,972,525 T767A possibly damaging Het
Polr3c T G 3: 96,716,471 I322L probably benign Het
Ppp1r26 C A 2: 28,450,848 H163Q probably benign Het
Prox1 T G 1: 190,162,008 Y80S probably damaging Het
Pygl T C 12: 70,210,979 probably null Het
Rab23 T C 1: 33,739,385 V236A probably benign Het
Setd2 T C 9: 110,569,813 probably null Het
Slc5a7 A G 17: 54,276,559 S568P probably benign Het
Smpd3 A G 8: 106,259,739 L477P probably damaging Het
Spg21 A G 9: 65,480,389 probably null Het
Spta1 A T 1: 174,192,977 I551F probably damaging Het
Supt5 A T 7: 28,325,972 I135N possibly damaging Het
Tacstd2 A G 6: 67,535,186 F174S probably damaging Het
Tas1r2 A T 4: 139,659,787 T186S probably damaging Het
Tie1 A G 4: 118,479,051 Y673H probably damaging Het
Tom1l1 A T 11: 90,671,126 N190K probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tox4 C T 14: 52,287,467 T249I probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Vmn2r13 A T 5: 109,175,199 F75I probably benign Het
Washc2 T A 6: 116,238,174 S502T possibly damaging Het
Wnk4 A T 11: 101,274,111 E755D probably benign Het
Zfp207 T A 11: 80,395,190 probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151442712 critical splice donor site probably null
IGL02175:Trmt1l APN 1 151448484 missense probably benign 0.00
IGL02348:Trmt1l APN 1 151450006 missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151439531 missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151433785 splice site probably benign
IGL03150:Trmt1l APN 1 151453892 missense probably benign 0.00
IGL03220:Trmt1l APN 1 151440941 splice site probably benign
canyonlands UTSW 1 151454048 nonsense probably null
IGL03014:Trmt1l UTSW 1 151457930 missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0240:Trmt1l UTSW 1 151457454 unclassified probably benign
R0267:Trmt1l UTSW 1 151457675 unclassified probably benign
R2084:Trmt1l UTSW 1 151440854 missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151435843 critical splice donor site probably null
R2338:Trmt1l UTSW 1 151428959 intron probably benign
R2408:Trmt1l UTSW 1 151439516 missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151433830 missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151453945 missense probably benign 0.14
R3972:Trmt1l UTSW 1 151433883 missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151455033 missense probably benign 0.18
R4361:Trmt1l UTSW 1 151435875 intron probably benign
R4411:Trmt1l UTSW 1 151452154 missense probably benign 0.02
R4419:Trmt1l UTSW 1 151440808 missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151448343 nonsense probably null
R4617:Trmt1l UTSW 1 151454048 nonsense probably null
R4618:Trmt1l UTSW 1 151454048 nonsense probably null
R4647:Trmt1l UTSW 1 151457881 missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151439569 missense probably benign 0.00
R4734:Trmt1l UTSW 1 151442637 missense probably benign 0.32
R4873:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R4875:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R5026:Trmt1l UTSW 1 151440876 missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151454995 missense probably benign
R5587:Trmt1l UTSW 1 151435704 intron probably benign
R5872:Trmt1l UTSW 1 151440843 missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151428953 intron probably benign
R6333:Trmt1l UTSW 1 151453934 missense probably benign 0.15
R6906:Trmt1l UTSW 1 151452175 missense probably benign 0.03
X0039:Trmt1l UTSW 1 151454990 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAACATTTCTTTTCCAGGTCAAGTTCC -3'
(R):5'- AGGGTGACAGGCTTTGCAG -3'

Sequencing Primer
(F):5'- AGGTCAAGTTCCCTTTTCAATACTGG -3'
(R):5'- AGTGTATGCCCAGCACTCTG -3'
Posted On2015-09-25