Incidental Mutation 'R4614:Lrrc40'
ID344923
Institutional Source Beutler Lab
Gene Symbol Lrrc40
Ensembl Gene ENSMUSG00000063052
Gene Nameleucine rich repeat containing 40
Synonyms2610040E16Rik
MMRRC Submission 041825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4614 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location158036662-158068487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158054634 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 344 (N344I)
Ref Sequence ENSEMBL: ENSMUSP00000071956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072080] [ENSMUST00000150525] [ENSMUST00000156597] [ENSMUST00000200540]
Predicted Effect probably damaging
Transcript: ENSMUST00000072080
AA Change: N344I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071956
Gene: ENSMUSG00000063052
AA Change: N344I

DomainStartEndE-ValueType
LRR 81 100 7.11e1 SMART
LRR 104 126 6.13e-1 SMART
LRR 127 149 1.51e0 SMART
LRR_TYP 150 172 8.47e-4 SMART
LRR 173 195 3.52e-1 SMART
LRR_TYP 196 219 2.91e-2 SMART
LRR 242 261 9.15e0 SMART
LRR 265 287 1.01e2 SMART
LRR 288 310 1.86e1 SMART
LRR 311 334 2.32e-1 SMART
LRR 335 356 2.21e2 SMART
LRR 471 493 1.86e0 SMART
LRR 494 517 8.97e0 SMART
LRR 541 564 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123028
SMART Domains Protein: ENSMUSP00000121905
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 37 68 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131518
SMART Domains Protein: ENSMUSP00000121417
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 80 110 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150525
SMART Domains Protein: ENSMUSP00000116475
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 81 111 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156597
Predicted Effect probably benign
Transcript: ENSMUST00000200540
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T G 13: 77,254,256 probably null Het
4932414N04Rik C A 2: 68,745,460 T701K probably benign Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Abcb11 A T 2: 69,284,681 H640Q possibly damaging Het
Ago2 C T 15: 73,130,967 V139M probably damaging Het
Apol11a A T 15: 77,516,572 K86N probably benign Het
Ass1 T C 2: 31,514,783 Y359H probably damaging Het
Bpifa3 A T 2: 154,136,280 N34I probably damaging Het
Brwd1 A T 16: 96,047,359 L540H probably damaging Het
C3ar1 G A 6: 122,850,721 S179F probably benign Het
Ccnb1ip1 T C 14: 50,792,195 T137A probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Cdk12 T A 11: 98,249,777 probably benign Het
Cep290 T C 10: 100,508,740 M480T probably benign Het
Cep290 G A 10: 100,559,687 R2112K possibly damaging Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cpeb1 A T 7: 81,436,270 D41E possibly damaging Het
Csf2rb2 C G 15: 78,291,702 C184S probably damaging Het
Ctsc G A 7: 88,278,375 probably null Het
Cyp2c40 G A 19: 39,803,856 S191L probably damaging Het
Dagla T C 19: 10,248,277 E841G probably damaging Het
Dld A T 12: 31,333,945 Y386* probably null Het
Dpp8 G A 9: 65,066,396 S634N probably benign Het
Duox2 A T 2: 122,289,557 V824E probably damaging Het
Dync2h1 A C 9: 7,011,290 S3634R probably benign Het
Eef1d T C 15: 75,903,576 N78S probably benign Het
Fcrl5 T A 3: 87,448,426 I482N probably damaging Het
Fezf1 A T 6: 23,247,858 C73S possibly damaging Het
Fgfr1 A G 8: 25,557,797 D53G probably benign Het
Fmn1 T C 2: 113,365,149 L398S unknown Het
Gm17175 T C 14: 51,571,585 Q108R probably benign Het
Gm28042 G A 2: 120,041,158 G669D probably damaging Het
Gm6185 A G 1: 161,223,099 noncoding transcript Het
Gucy2g A T 19: 55,202,147 C1018* probably null Het
H2-Q10 A T 17: 35,474,020 probably benign Het
H2-T22 T G 17: 36,040,537 Q267P probably benign Het
Hibadh A G 6: 52,546,930 Y328H possibly damaging Het
Hsd3b3 T A 3: 98,742,080 Y309F probably benign Het
Ighv1-37 C T 12: 114,896,243 A116T probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Iqch A G 9: 63,482,581 M733T probably benign Het
Jakmip2 T A 18: 43,562,592 D539V probably damaging Het
Lgi2 A G 5: 52,538,433 S395P probably damaging Het
Ltbp1 G A 17: 75,289,994 probably benign Het
Metap1d C T 2: 71,524,948 P332L probably benign Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mis18bp1 T A 12: 65,153,529 probably benign Het
Mta2 T C 19: 8,948,128 probably null Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Muc4 A G 16: 32,757,058 K241E probably benign Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Nfs1 A G 2: 156,144,050 S31P probably benign Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr419 A G 1: 174,250,622 F102L possibly damaging Het
Olfr981 T A 9: 40,022,959 C189S probably damaging Het
Otogl A T 10: 107,892,124 C245* probably null Het
Pcdhb16 G A 18: 37,480,345 G786D probably benign Het
Pdcd5 C T 7: 35,647,047 probably benign Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Piezo1 A T 8: 122,486,411 I1871N probably benign Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Plxnd1 T C 6: 115,972,525 T767A possibly damaging Het
Polr3c T G 3: 96,716,471 I322L probably benign Het
Ppp1r26 C A 2: 28,450,848 H163Q probably benign Het
Prox1 T G 1: 190,162,008 Y80S probably damaging Het
Pygl T C 12: 70,210,979 probably null Het
Rab23 T C 1: 33,739,385 V236A probably benign Het
Setd2 T C 9: 110,569,813 probably null Het
Slc5a7 A G 17: 54,276,559 S568P probably benign Het
Smpd3 A G 8: 106,259,739 L477P probably damaging Het
Spg21 A G 9: 65,480,389 probably null Het
Spta1 A T 1: 174,192,977 I551F probably damaging Het
Supt5 A T 7: 28,325,972 I135N possibly damaging Het
Tacstd2 A G 6: 67,535,186 F174S probably damaging Het
Tas1r2 A T 4: 139,659,787 T186S probably damaging Het
Tie1 A G 4: 118,479,051 Y673H probably damaging Het
Tom1l1 A T 11: 90,671,126 N190K probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tox4 C T 14: 52,287,467 T249I probably damaging Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Vmn2r13 A T 5: 109,175,199 F75I probably benign Het
Washc2 T A 6: 116,238,174 S502T possibly damaging Het
Wnk4 A T 11: 101,274,111 E755D probably benign Het
Zfp207 T A 11: 80,395,190 probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Lrrc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Lrrc40 APN 3 158048450 missense probably damaging 1.00
IGL00501:Lrrc40 APN 3 158061282 missense probably damaging 0.96
IGL00727:Lrrc40 APN 3 158063871 critical splice donor site probably null
IGL01349:Lrrc40 APN 3 158058665 splice site probably benign
IGL02377:Lrrc40 APN 3 158036728 start codon destroyed probably null 1.00
IGL02490:Lrrc40 APN 3 158062699 missense probably damaging 1.00
IGL02657:Lrrc40 APN 3 158036773 missense probably damaging 1.00
IGL02879:Lrrc40 APN 3 158041665 intron probably benign
IGL02944:Lrrc40 APN 3 158041665 intron probably benign
IGL02954:Lrrc40 APN 3 158041665 intron probably benign
IGL02966:Lrrc40 APN 3 158041665 intron probably benign
IGL03004:Lrrc40 APN 3 158041665 intron probably benign
IGL03032:Lrrc40 APN 3 158041665 intron probably benign
IGL03112:Lrrc40 APN 3 158041665 intron probably benign
IGL03163:Lrrc40 APN 3 158041587 missense possibly damaging 0.82
I2288:Lrrc40 UTSW 3 158052789 missense probably damaging 1.00
R0266:Lrrc40 UTSW 3 158041661 critical splice donor site probably null
R0355:Lrrc40 UTSW 3 158040471 missense probably damaging 0.99
R0457:Lrrc40 UTSW 3 158054564 intron probably null
R0968:Lrrc40 UTSW 3 158036789 missense probably damaging 1.00
R1799:Lrrc40 UTSW 3 158036804 missense probably benign 0.38
R1962:Lrrc40 UTSW 3 158040449 missense probably benign 0.01
R4825:Lrrc40 UTSW 3 158061330 nonsense probably null
R4857:Lrrc40 UTSW 3 158066229 utr 3 prime probably benign
R4947:Lrrc40 UTSW 3 158063835 missense probably benign 0.00
R5148:Lrrc40 UTSW 3 158054569 splice site probably null
R5673:Lrrc40 UTSW 3 158048398 splice site probably null
R6354:Lrrc40 UTSW 3 158061264 nonsense probably null
R6382:Lrrc40 UTSW 3 158058696 missense probably damaging 0.98
R6713:Lrrc40 UTSW 3 158063713 missense probably benign 0.00
R7081:Lrrc40 UTSW 3 158036805 missense not run
R7098:Lrrc40 UTSW 3 158041639 missense not run
V1662:Lrrc40 UTSW 3 158052789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGGAAATGTATCTGGCC -3'
(R):5'- TTGCTGCGCAGGTATTTTAGAAC -3'

Sequencing Primer
(F):5'- GGAAATGTATCTGGCCATCTTTC -3'
(R):5'- CGCAGGTATTTTAGAACTTCTTGAG -3'
Posted On2015-09-25