Incidental Mutation 'R4614:Cpeb1'
ID344945
Institutional Source Beutler Lab
Gene Symbol Cpeb1
Ensembl Gene ENSMUSG00000025586
Gene Namecytoplasmic polyadenylation element binding protein 1
Synonyms
MMRRC Submission 041825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4614 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81347026-81455465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81436270 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 41 (D41E)
Ref Sequence ENSEMBL: ENSMUSP00000137079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098331] [ENSMUST00000130310] [ENSMUST00000178892]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098331
AA Change: D41E

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095936
Gene: ENSMUSG00000025586
AA Change: D41E

DomainStartEndE-ValueType
low complexity region 112 126 N/A INTRINSIC
low complexity region 176 195 N/A INTRINSIC
RRM 311 386 2.6e-4 SMART
RRM_2 430 506 2.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124937
Predicted Effect possibly damaging
Transcript: ENSMUST00000130310
AA Change: D36E

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120139
Gene: ENSMUSG00000025586
AA Change: D36E

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 171 190 N/A INTRINSIC
RRM 306 376 1.35e-1 SMART
RRM 420 496 6.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135177
Predicted Effect possibly damaging
Transcript: ENSMUST00000178892
AA Change: D41E

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137079
Gene: ENSMUSG00000025586
AA Change: D41E

DomainStartEndE-ValueType
Pfam:CEBP1_N 1 307 2.5e-153 PFAM
RRM 312 387 6.25e-2 SMART
RRM 431 507 6.36e-1 SMART
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoplasmic polyadenylation element binding protein family. This highly conserved protein binds to a specific RNA sequence, called the cytoplasmic polyadenylation element, found in the 3' untranslated region of some mRNAs. The encoded protein functions in both the cytoplasm and the nucleus. It is involved in the regulation of mRNA translation, as well as processing of the 3' untranslated region, and may play a role in cell proliferation and tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele are viable and overtly normal but display a developmental arrest of both female and male germ cells at the pachytene stage, defective synaptonemal complex formation, and impaired neuronal synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T G 13: 77,254,256 probably null Het
4932414N04Rik C A 2: 68,745,460 T701K probably benign Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Abcb11 A T 2: 69,284,681 H640Q possibly damaging Het
Ago2 C T 15: 73,130,967 V139M probably damaging Het
Apol11a A T 15: 77,516,572 K86N probably benign Het
Ass1 T C 2: 31,514,783 Y359H probably damaging Het
Bpifa3 A T 2: 154,136,280 N34I probably damaging Het
Brwd1 A T 16: 96,047,359 L540H probably damaging Het
C3ar1 G A 6: 122,850,721 S179F probably benign Het
Ccnb1ip1 T C 14: 50,792,195 T137A probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Cdk12 T A 11: 98,249,777 probably benign Het
Cep290 T C 10: 100,508,740 M480T probably benign Het
Cep290 G A 10: 100,559,687 R2112K possibly damaging Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Csf2rb2 C G 15: 78,291,702 C184S probably damaging Het
Ctsc G A 7: 88,278,375 probably null Het
Cyp2c40 G A 19: 39,803,856 S191L probably damaging Het
Dagla T C 19: 10,248,277 E841G probably damaging Het
Dld A T 12: 31,333,945 Y386* probably null Het
Dpp8 G A 9: 65,066,396 S634N probably benign Het
Duox2 A T 2: 122,289,557 V824E probably damaging Het
Dync2h1 A C 9: 7,011,290 S3634R probably benign Het
Eef1d T C 15: 75,903,576 N78S probably benign Het
Fcrl5 T A 3: 87,448,426 I482N probably damaging Het
Fezf1 A T 6: 23,247,858 C73S possibly damaging Het
Fgfr1 A G 8: 25,557,797 D53G probably benign Het
Fmn1 T C 2: 113,365,149 L398S unknown Het
Gm17175 T C 14: 51,571,585 Q108R probably benign Het
Gm28042 G A 2: 120,041,158 G669D probably damaging Het
Gm6185 A G 1: 161,223,099 noncoding transcript Het
Gucy2g A T 19: 55,202,147 C1018* probably null Het
H2-Q10 A T 17: 35,474,020 probably benign Het
H2-T22 T G 17: 36,040,537 Q267P probably benign Het
Hibadh A G 6: 52,546,930 Y328H possibly damaging Het
Hsd3b3 T A 3: 98,742,080 Y309F probably benign Het
Ighv1-37 C T 12: 114,896,243 A116T probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Iqch A G 9: 63,482,581 M733T probably benign Het
Jakmip2 T A 18: 43,562,592 D539V probably damaging Het
Lgi2 A G 5: 52,538,433 S395P probably damaging Het
Lrrc40 A T 3: 158,054,634 N344I probably damaging Het
Ltbp1 G A 17: 75,289,994 probably benign Het
Metap1d C T 2: 71,524,948 P332L probably benign Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mis18bp1 T A 12: 65,153,529 probably benign Het
Mta2 T C 19: 8,948,128 probably null Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Muc4 A G 16: 32,757,058 K241E probably benign Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Nfs1 A G 2: 156,144,050 S31P probably benign Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr419 A G 1: 174,250,622 F102L possibly damaging Het
Olfr981 T A 9: 40,022,959 C189S probably damaging Het
Otogl A T 10: 107,892,124 C245* probably null Het
Pcdhb16 G A 18: 37,480,345 G786D probably benign Het
Pdcd5 C T 7: 35,647,047 probably benign Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Piezo1 A T 8: 122,486,411 I1871N probably benign Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Plxnd1 T C 6: 115,972,525 T767A possibly damaging Het
Polr3c T G 3: 96,716,471 I322L probably benign Het
Ppp1r26 C A 2: 28,450,848 H163Q probably benign Het
Prox1 T G 1: 190,162,008 Y80S probably damaging Het
Pygl T C 12: 70,210,979 probably null Het
Rab23 T C 1: 33,739,385 V236A probably benign Het
Setd2 T C 9: 110,569,813 probably null Het
Slc5a7 A G 17: 54,276,559 S568P probably benign Het
Smpd3 A G 8: 106,259,739 L477P probably damaging Het
Spg21 A G 9: 65,480,389 probably null Het
Spta1 A T 1: 174,192,977 I551F probably damaging Het
Supt5 A T 7: 28,325,972 I135N possibly damaging Het
Tacstd2 A G 6: 67,535,186 F174S probably damaging Het
Tas1r2 A T 4: 139,659,787 T186S probably damaging Het
Tie1 A G 4: 118,479,051 Y673H probably damaging Het
Tom1l1 A T 11: 90,671,126 N190K probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tox4 C T 14: 52,287,467 T249I probably damaging Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Vmn2r13 A T 5: 109,175,199 F75I probably benign Het
Washc2 T A 6: 116,238,174 S502T possibly damaging Het
Wnk4 A T 11: 101,274,111 E755D probably benign Het
Zfp207 T A 11: 80,395,190 probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Cpeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cpeb1 APN 7 81372181 missense probably benign
IGL01598:Cpeb1 APN 7 81361801 missense probably benign
IGL02214:Cpeb1 APN 7 81372057 missense possibly damaging 0.89
IGL02527:Cpeb1 APN 7 81359887 missense probably damaging 1.00
IGL02878:Cpeb1 APN 7 81357326 missense probably damaging 1.00
IGL03065:Cpeb1 APN 7 81436290 missense probably benign 0.39
IGL03305:Cpeb1 APN 7 81361716 missense probably benign 0.16
R0391:Cpeb1 UTSW 7 81361725 missense possibly damaging 0.89
R0711:Cpeb1 UTSW 7 81351870 missense probably benign 0.01
R1626:Cpeb1 UTSW 7 81436247 missense probably damaging 1.00
R1723:Cpeb1 UTSW 7 81436226 missense probably benign 0.29
R1902:Cpeb1 UTSW 7 81372119 missense probably benign 0.03
R4773:Cpeb1 UTSW 7 81355947 missense probably benign
R5256:Cpeb1 UTSW 7 81351839 missense probably damaging 1.00
R5750:Cpeb1 UTSW 7 81436351 missense probably benign 0.01
R5927:Cpeb1 UTSW 7 81361680 missense possibly damaging 0.69
R6000:Cpeb1 UTSW 7 81361680 missense possibly damaging 0.69
R6526:Cpeb1 UTSW 7 81361669 missense probably benign
X0067:Cpeb1 UTSW 7 81359727 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGACTCAGTGTGCTCTTCAC -3'
(R):5'- GCATTGATGTGTAGGCAGTAAAATG -3'

Sequencing Primer
(F):5'- TGCTCTTCACAGGCCTCCAATAAG -3'
(R):5'- GGCAGTAAAATGAAGTCTTTGTTGC -3'
Posted On2015-09-25