Incidental Mutation 'R4614:Phkg2'
ID344947
Institutional Source Beutler Lab
Gene Symbol Phkg2
Ensembl Gene ENSMUSG00000030815
Gene Namephosphorylase kinase, gamma 2 (testis)
Synonyms
MMRRC Submission 041825-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R4614 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127573340-127583307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127577620 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 61 (R61W)
Ref Sequence ENSEMBL: ENSMUSP00000145927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033086] [ENSMUST00000072155] [ENSMUST00000121004] [ENSMUST00000146383] [ENSMUST00000154891] [ENSMUST00000205633]
Predicted Effect probably damaging
Transcript: ENSMUST00000033086
AA Change: R61W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033086
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121004
AA Change: R61W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113533
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138158
Predicted Effect probably damaging
Transcript: ENSMUST00000146383
AA Change: R61W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115593
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
Pfam:Pkinase 24 85 8.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151908
Predicted Effect unknown
Transcript: ENSMUST00000154891
AA Change: R61W
SMART Domains Protein: ENSMUSP00000116860
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
Pfam:Pkinase 24 78 4.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190938
Predicted Effect probably damaging
Transcript: ENSMUST00000205633
AA Change: R61W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206818
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T G 13: 77,254,256 probably null Het
4932414N04Rik C A 2: 68,745,460 T701K probably benign Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Abcb11 A T 2: 69,284,681 H640Q possibly damaging Het
Ago2 C T 15: 73,130,967 V139M probably damaging Het
Apol11a A T 15: 77,516,572 K86N probably benign Het
Ass1 T C 2: 31,514,783 Y359H probably damaging Het
Bpifa3 A T 2: 154,136,280 N34I probably damaging Het
Brwd1 A T 16: 96,047,359 L540H probably damaging Het
C3ar1 G A 6: 122,850,721 S179F probably benign Het
Ccnb1ip1 T C 14: 50,792,195 T137A probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Cdk12 T A 11: 98,249,777 probably benign Het
Cep290 T C 10: 100,508,740 M480T probably benign Het
Cep290 G A 10: 100,559,687 R2112K possibly damaging Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cpeb1 A T 7: 81,436,270 D41E possibly damaging Het
Csf2rb2 C G 15: 78,291,702 C184S probably damaging Het
Ctsc G A 7: 88,278,375 probably null Het
Cyp2c40 G A 19: 39,803,856 S191L probably damaging Het
Dagla T C 19: 10,248,277 E841G probably damaging Het
Dld A T 12: 31,333,945 Y386* probably null Het
Dpp8 G A 9: 65,066,396 S634N probably benign Het
Duox2 A T 2: 122,289,557 V824E probably damaging Het
Dync2h1 A C 9: 7,011,290 S3634R probably benign Het
Eef1d T C 15: 75,903,576 N78S probably benign Het
Fcrl5 T A 3: 87,448,426 I482N probably damaging Het
Fezf1 A T 6: 23,247,858 C73S possibly damaging Het
Fgfr1 A G 8: 25,557,797 D53G probably benign Het
Fmn1 T C 2: 113,365,149 L398S unknown Het
Gm17175 T C 14: 51,571,585 Q108R probably benign Het
Gm28042 G A 2: 120,041,158 G669D probably damaging Het
Gm6185 A G 1: 161,223,099 noncoding transcript Het
Gucy2g A T 19: 55,202,147 C1018* probably null Het
H2-Q10 A T 17: 35,474,020 probably benign Het
H2-T22 T G 17: 36,040,537 Q267P probably benign Het
Hibadh A G 6: 52,546,930 Y328H possibly damaging Het
Hsd3b3 T A 3: 98,742,080 Y309F probably benign Het
Ighv1-37 C T 12: 114,896,243 A116T probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Iqch A G 9: 63,482,581 M733T probably benign Het
Jakmip2 T A 18: 43,562,592 D539V probably damaging Het
Lgi2 A G 5: 52,538,433 S395P probably damaging Het
Lrrc40 A T 3: 158,054,634 N344I probably damaging Het
Ltbp1 G A 17: 75,289,994 probably benign Het
Metap1d C T 2: 71,524,948 P332L probably benign Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mis18bp1 T A 12: 65,153,529 probably benign Het
Mta2 T C 19: 8,948,128 probably null Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Muc4 A G 16: 32,757,058 K241E probably benign Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Nfs1 A G 2: 156,144,050 S31P probably benign Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr419 A G 1: 174,250,622 F102L possibly damaging Het
Olfr981 T A 9: 40,022,959 C189S probably damaging Het
Otogl A T 10: 107,892,124 C245* probably null Het
Pcdhb16 G A 18: 37,480,345 G786D probably benign Het
Pdcd5 C T 7: 35,647,047 probably benign Het
Piezo1 A T 8: 122,486,411 I1871N probably benign Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Plxnd1 T C 6: 115,972,525 T767A possibly damaging Het
Polr3c T G 3: 96,716,471 I322L probably benign Het
Ppp1r26 C A 2: 28,450,848 H163Q probably benign Het
Prox1 T G 1: 190,162,008 Y80S probably damaging Het
Pygl T C 12: 70,210,979 probably null Het
Rab23 T C 1: 33,739,385 V236A probably benign Het
Setd2 T C 9: 110,569,813 probably null Het
Slc5a7 A G 17: 54,276,559 S568P probably benign Het
Smpd3 A G 8: 106,259,739 L477P probably damaging Het
Spg21 A G 9: 65,480,389 probably null Het
Spta1 A T 1: 174,192,977 I551F probably damaging Het
Supt5 A T 7: 28,325,972 I135N possibly damaging Het
Tacstd2 A G 6: 67,535,186 F174S probably damaging Het
Tas1r2 A T 4: 139,659,787 T186S probably damaging Het
Tie1 A G 4: 118,479,051 Y673H probably damaging Het
Tom1l1 A T 11: 90,671,126 N190K probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tox4 C T 14: 52,287,467 T249I probably damaging Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Vmn2r13 A T 5: 109,175,199 F75I probably benign Het
Washc2 T A 6: 116,238,174 S502T possibly damaging Het
Wnk4 A T 11: 101,274,111 E755D probably benign Het
Zfp207 T A 11: 80,395,190 probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Phkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Phkg2 APN 7 127582340 missense probably damaging 1.00
IGL02259:Phkg2 APN 7 127582286 intron probably benign
IGL02699:Phkg2 APN 7 127582550 missense probably benign
IGL03039:Phkg2 APN 7 127579694 nonsense probably null
R0326:Phkg2 UTSW 7 127573903 missense probably damaging 1.00
R2141:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R2142:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R2763:Phkg2 UTSW 7 127579833 missense probably benign 0.00
R4615:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4616:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4666:Phkg2 UTSW 7 127577984 missense possibly damaging 0.93
R4981:Phkg2 UTSW 7 127582379 missense probably damaging 1.00
R4993:Phkg2 UTSW 7 127573941 missense probably damaging 1.00
R5287:Phkg2 UTSW 7 127582757 frame shift probably null
R5416:Phkg2 UTSW 7 127582935 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AAGCTCGATGTGGTGGTGC -3'
(R):5'- AGGCAATTCTAGGGTGTGGG -3'

Sequencing Primer
(F):5'- CACCCAGTCTTACAGGATGTGATG -3'
(R):5'- GTGGGTCATGAATAGGGCC -3'
Posted On2015-09-25