Incidental Mutation 'R0103:Tnfaip2'
ID34497
Institutional Source Beutler Lab
Gene Symbol Tnfaip2
Ensembl Gene ENSMUSG00000021281
Gene Nametumor necrosis factor, alpha-induced protein 2
SynonymsTnfaip2, tnfb94, Tnfip2
MMRRC Submission 038389-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0103 (G1)
Quality Score148
Status Validated (trace)
Chromosome12
Chromosomal Location111442469-111455018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111445810 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 215 (T215M)
Ref Sequence ENSEMBL: ENSMUSP00000105415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102745] [ENSMUST00000109792] [ENSMUST00000129467] [ENSMUST00000172783] [ENSMUST00000174298]
Predicted Effect probably benign
Transcript: ENSMUST00000102745
AA Change: T215M

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099806
Gene: ENSMUSG00000021281
AA Change: T215M

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 688 1.3e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109792
AA Change: T215M

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105415
Gene: ENSMUSG00000021281
AA Change: T215M

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 705 1.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127207
Predicted Effect probably benign
Transcript: ENSMUST00000129467
SMART Domains Protein: ENSMUSP00000133274
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156003
Predicted Effect probably benign
Transcript: ENSMUST00000172783
SMART Domains Protein: ENSMUSP00000133635
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173581
Predicted Effect probably benign
Transcript: ENSMUST00000174298
SMART Domains Protein: ENSMUSP00000133317
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
low complexity region 65 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221429
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. The expression of this gene was shown to be induced by retinoic acid in a cell line expressing a oncogenic version of the retinoic acid receptor alpha fusion protein, which suggested that this gene may be a retinoic acid target gene in acute promyelocytic leukemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,273,951 R443S probably damaging Het
Anapc1 T C 2: 128,680,452 probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arfgap3 A T 15: 83,322,721 probably benign Het
Asah2 G T 19: 32,018,977 H374N probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Ccdc106 C A 7: 5,057,545 Q35K probably benign Het
Ccm2l G T 2: 153,067,919 E64* probably null Het
Cep85l A T 10: 53,278,174 D776E possibly damaging Het
Cfap52 T A 11: 67,925,125 I611F possibly damaging Het
Cldn22 C T 8: 47,824,554 T9M probably benign Het
Coa7 T C 4: 108,338,141 L89P possibly damaging Het
Cox7a2l A T 17: 83,514,272 Y2N probably damaging Het
Ctns A C 11: 73,185,311 I299M probably damaging Het
Cyp27a1 A C 1: 74,735,915 E301A probably benign Het
Cyp2b13 A T 7: 26,088,710 K421M probably damaging Het
Cyp4f40 G T 17: 32,676,308 C468F probably damaging Het
Cyp4f40 C A 17: 32,676,309 C468* probably null Het
Dcun1d5 G A 9: 7,188,788 C74Y probably damaging Het
Dennd4c A G 4: 86,812,446 Y860C probably benign Het
Dgkz T C 2: 91,934,205 T1028A probably benign Het
Dhx58 T C 11: 100,695,270 T642A probably damaging Het
Dlg4 A G 11: 70,031,193 Y87C probably damaging Het
Dnah6 C T 6: 73,092,172 E2511K probably damaging Het
Entpd5 C A 12: 84,396,943 E9* probably null Het
Fbln2 A C 6: 91,271,550 I1066L probably benign Het
Fhl2 C T 1: 43,153,221 R4H probably benign Het
Frmpd1 T A 4: 45,229,884 I17K probably damaging Het
Gbp7 T A 3: 142,546,538 N627K probably benign Het
Gm20388 A G 8: 122,269,733 probably benign Het
Gnptab A G 10: 88,429,519 Y331C probably damaging Het
Hdac4 T C 1: 91,975,644 E521G possibly damaging Het
Hibadh T A 6: 52,557,877 M173L probably benign Het
Iba57 C T 11: 59,163,613 A27T probably benign Het
Itga1 T C 13: 115,016,254 I211V probably benign Het
Keg1 A T 19: 12,718,916 I155F possibly damaging Het
Krt84 T C 15: 101,530,236 E272G probably damaging Het
Lrp2 C A 2: 69,477,040 V2892L probably benign Het
Ltb A G 17: 35,195,040 probably benign Het
Masp1 G A 16: 23,458,018 P579L probably damaging Het
Mtor T A 4: 148,533,902 M1724K probably benign Het
Myo3a T G 2: 22,544,322 probably benign Het
Myo9b C T 8: 71,323,849 probably benign Het
Ncor1 G T 11: 62,343,045 Q444K possibly damaging Het
Nek7 A T 1: 138,544,242 C53* probably null Het
Obscn G T 11: 59,062,696 Y4044* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Pcdh15 A T 10: 74,210,425 D178V probably damaging Het
Pcsk6 T C 7: 65,929,097 probably benign Het
Phxr4 T C 9: 13,431,791 probably benign Het
Pkhd1 T A 1: 20,523,359 D1510V probably benign Het
Pkhd1l1 T C 15: 44,597,141 C4249R probably benign Het
Plxnb2 A G 15: 89,161,769 Y968H possibly damaging Het
Prpf39 T C 12: 65,055,283 V378A possibly damaging Het
Psd2 A G 18: 36,004,717 N455S probably damaging Het
Ptch2 C A 4: 117,109,425 probably benign Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rad9b A T 5: 122,331,527 V348E probably damaging Het
Rcor1 T C 12: 111,109,778 probably benign Het
Rhoc A T 3: 104,791,991 E32V possibly damaging Het
Rnf40 T G 7: 127,600,571 V925G probably damaging Het
Rptor G T 11: 119,884,967 R988L probably benign Het
Slc25a32 A T 15: 39,099,897 Y176* probably null Het
Slc7a1 T A 5: 148,352,426 K4* probably null Het
Ss18 A C 18: 14,679,421 Y38D probably damaging Het
Syt4 T A 18: 31,447,220 probably benign Het
Taar4 A T 10: 23,961,406 N305Y probably damaging Het
Taar7b A T 10: 24,000,294 Y119F probably benign Het
Tcaf1 G T 6: 42,686,390 D185E probably benign Het
Tmem138 T C 19: 10,574,952 N62S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnfrsf25 C T 4: 152,116,948 P65S possibly damaging Het
Trp53bp1 A T 2: 121,236,759 S495R possibly damaging Het
Trpv3 T C 11: 73,293,979 F597S probably damaging Het
Tsc22d4 A C 5: 137,747,116 M1L possibly damaging Het
Ttc39a A G 4: 109,421,453 probably null Het
Ttn T G 2: 76,761,226 H21033P probably damaging Het
Ugt2a3 A G 5: 87,336,718 V149A possibly damaging Het
Ush2a T G 1: 188,319,070 I251R possibly damaging Het
Vamp4 T C 1: 162,589,539 C114R possibly damaging Het
Wdr33 T C 18: 31,833,335 V135A probably damaging Het
Zc3h13 T A 14: 75,330,468 V1067E probably damaging Het
Zcwpw1 G A 5: 137,810,113 W274* probably null Het
Zfp219 T A 14: 52,006,706 H627L probably damaging Het
Other mutations in Tnfaip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Tnfaip2 APN 12 111453549 missense probably damaging 1.00
IGL01352:Tnfaip2 APN 12 111445619 missense probably damaging 1.00
IGL02550:Tnfaip2 APN 12 111446101 missense probably damaging 1.00
R0145:Tnfaip2 UTSW 12 111445858 missense possibly damaging 0.87
R0324:Tnfaip2 UTSW 12 111453459 missense probably damaging 1.00
R0609:Tnfaip2 UTSW 12 111453507 missense probably benign 0.01
R0837:Tnfaip2 UTSW 12 111450707 missense probably damaging 1.00
R1353:Tnfaip2 UTSW 12 111444969 missense probably damaging 1.00
R1366:Tnfaip2 UTSW 12 111449322 missense probably benign 0.00
R1988:Tnfaip2 UTSW 12 111449891 critical splice donor site probably null
R2109:Tnfaip2 UTSW 12 111448093 missense probably damaging 1.00
R2147:Tnfaip2 UTSW 12 111446022 missense probably damaging 1.00
R4003:Tnfaip2 UTSW 12 111451344 splice site probably benign
R4402:Tnfaip2 UTSW 12 111449851 missense probably benign 0.43
R4690:Tnfaip2 UTSW 12 111445248 missense possibly damaging 0.66
R4718:Tnfaip2 UTSW 12 111446029 missense possibly damaging 0.95
R5271:Tnfaip2 UTSW 12 111448460 intron probably benign
R6478:Tnfaip2 UTSW 12 111445663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGGTCCTGAATGGGACATTG -3'
(R):5'- GCAGCAGCAAGTAGGTATCCCTTTC -3'

Sequencing Primer
(F):5'- CTGAATGGGACATTGGCCTC -3'
(R):5'- TTGAACTCGTCGGGGAAC -3'
Posted On2013-05-09