Incidental Mutation 'R4615:Taf3'
ID344997
Institutional Source Beutler Lab
Gene Symbol Taf3
Ensembl Gene ENSMUSG00000025782
Gene NameTATA-box binding protein associated factor 3
SynonymsmTAFII140, 4933439M23Rik
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location9914552-10048596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9952090 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 422 (T422I)
Ref Sequence ENSEMBL: ENSMUSP00000026888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026888] [ENSMUST00000114909]
PDB Structure
Solution structure of the free TAF3 PHD domain [SOLUTION NMR]
Solution structure of the TAF3 PHD domain in complex with a H3K4me3 peptide [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000026888
AA Change: T422I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026888
Gene: ENSMUSG00000025782
AA Change: T422I

DomainStartEndE-ValueType
BTP 3 79 1.94e-34 SMART
low complexity region 159 173 N/A INTRINSIC
low complexity region 237 253 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
coiled coil region 519 572 N/A INTRINSIC
coiled coil region 611 651 N/A INTRINSIC
coiled coil region 692 751 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
low complexity region 795 821 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
PHD 869 915 4.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114909
AA Change: T269I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110559
Gene: ENSMUSG00000025782
AA Change: T269I

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 84 100 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 251 270 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 334 352 N/A INTRINSIC
coiled coil region 366 419 N/A INTRINSIC
coiled coil region 458 498 N/A INTRINSIC
coiled coil region 539 598 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 642 668 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
PHD 716 762 4.77e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The highly conserved RNA polymerase II transcription factor TFIID (see TAF1; MIM 313650) comprises the TATA box-binding protein (TBP; MIM 600075) and a set of TBP-associated factors (TAFs), including TAF3. TAFs contribute to promoter recognition and selectivity and act as antiapoptotic factors (Gangloff et al., 2001 [PubMed 11438666]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Taf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Taf3 APN 2 9952917 missense probably damaging 1.00
IGL01620:Taf3 APN 2 9952661 missense probably benign 0.00
IGL02084:Taf3 APN 2 10042519 missense probably benign 0.08
IGL02229:Taf3 APN 2 9952834 missense probably damaging 1.00
IGL02891:Taf3 APN 2 9921227 missense probably damaging 1.00
IGL03173:Taf3 APN 2 9952927 missense probably damaging 0.99
IGL03302:Taf3 APN 2 9952131 missense probably damaging 1.00
Howard UTSW 2 9951160 missense probably damaging 0.99
R0344:Taf3 UTSW 2 9951898 missense probably benign 0.05
R0348:Taf3 UTSW 2 10042644 missense probably benign 0.05
R0506:Taf3 UTSW 2 9940993 missense possibly damaging 0.68
R1724:Taf3 UTSW 2 9952366 missense probably benign 0.01
R2151:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2154:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2495:Taf3 UTSW 2 9952833 missense probably damaging 1.00
R3702:Taf3 UTSW 2 9952561 missense possibly damaging 0.74
R3739:Taf3 UTSW 2 9951658 missense possibly damaging 0.89
R3921:Taf3 UTSW 2 10048298 missense probably benign 0.06
R4097:Taf3 UTSW 2 9952367 missense possibly damaging 0.54
R4602:Taf3 UTSW 2 9952657 missense probably damaging 0.96
R4679:Taf3 UTSW 2 10048564 utr 5 prime probably benign
R4789:Taf3 UTSW 2 9951959 missense probably damaging 1.00
R4801:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R4802:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R5201:Taf3 UTSW 2 9952184 missense probably damaging 1.00
R5522:Taf3 UTSW 2 9941005 missense probably damaging 1.00
R5629:Taf3 UTSW 2 9918178 missense probably damaging 1.00
R6427:Taf3 UTSW 2 9951353 missense probably damaging 0.98
R6492:Taf3 UTSW 2 9951160 missense probably damaging 0.99
R6804:Taf3 UTSW 2 9918217 missense possibly damaging 0.91
R7282:Taf3 UTSW 2 9951442 missense probably damaging 0.96
R7293:Taf3 UTSW 2 9952090 missense probably damaging 0.98
R7368:Taf3 UTSW 2 9916377 missense unknown
Predicted Primers PCR Primer
(F):5'- TACCCCTTGTGTAGAGGCTC -3'
(R):5'- ATAGGACCCCTTCAGCCATG -3'

Sequencing Primer
(F):5'- CCCTTGTGTAGAGGCTCAGGAG -3'
(R):5'- TGTTAAAGAGACCATCCCAGTG -3'
Posted On2015-09-25