Incidental Mutation 'R4615:Tox2'
ID345003
Institutional Source Beutler Lab
Gene Symbol Tox2
Ensembl Gene ENSMUSG00000074607
Gene NameTOX high mobility group box family member 2
SynonymsLOC269389, RxHMG1
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4615 (G1)
Quality Score207
Status Not validated
Chromosome2
Chromosomal Location163203125-163324170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163320647 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 479 (L479P)
Ref Sequence ENSEMBL: ENSMUSP00000096710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099110] [ENSMUST00000109428] [ENSMUST00000165937]
Predicted Effect probably damaging
Transcript: ENSMUST00000099110
AA Change: L479P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096710
Gene: ENSMUSG00000074607
AA Change: L479P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 20 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
HMG 287 357 1.44e-18 SMART
low complexity region 424 451 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 499 524 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109428
AA Change: L437P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105055
Gene: ENSMUSG00000074607
AA Change: L437P

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
HMG 245 315 1.44e-18 SMART
low complexity region 382 409 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
low complexity region 457 482 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148599
AA Change: L90P
SMART Domains Protein: ENSMUSP00000118219
Gene: ENSMUSG00000074607
AA Change: L90P

DomainStartEndE-ValueType
low complexity region 36 63 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165937
AA Change: L444P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126243
Gene: ENSMUSG00000074607
AA Change: L444P

DomainStartEndE-ValueType
low complexity region 75 87 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
HMG 252 322 1.44e-18 SMART
low complexity region 389 416 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Tox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Tox2 APN 2 163225466 utr 5 prime probably benign
IGL01891:Tox2 APN 2 163322983 missense possibly damaging 0.48
IGL02190:Tox2 APN 2 163323006 missense possibly damaging 0.91
IGL02576:Tox2 APN 2 163276180 missense probably damaging 0.99
R0881:Tox2 UTSW 2 163321445 missense probably benign 0.18
R1739:Tox2 UTSW 2 163247785 missense probably damaging 0.99
R1742:Tox2 UTSW 2 163225526 missense probably benign 0.04
R1900:Tox2 UTSW 2 163276167 missense probably damaging 1.00
R1937:Tox2 UTSW 2 163225556 missense probably benign
R2345:Tox2 UTSW 2 163319598 missense probably damaging 1.00
R2842:Tox2 UTSW 2 163204630 intron probably benign
R3753:Tox2 UTSW 2 163314323 missense probably damaging 1.00
R4614:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4616:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4618:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4625:Tox2 UTSW 2 163314416 missense possibly damaging 0.71
R5410:Tox2 UTSW 2 163320373 missense probably benign 0.04
R5493:Tox2 UTSW 2 163204729 nonsense probably null
R6731:Tox2 UTSW 2 163320377 missense probably damaging 1.00
R6965:Tox2 UTSW 2 163323010 makesense probably null
R7038:Tox2 UTSW 2 163314344 missense probably damaging 0.99
R7078:Tox2 UTSW 2 163320581 missense
R7422:Tox2 UTSW 2 163321515 missense
Predicted Primers PCR Primer
(F):5'- TGAGGCCAAGAACACTCAGG -3'
(R):5'- TGAGAGAGCCAATGTCTCTCC -3'

Sequencing Primer
(F):5'- AGCAGCCCATGTACGCC -3'
(R):5'- CTCCAGGCAGGTGTTTTAGACC -3'
Posted On2015-09-25